Rw2G050760

gag-polypeptide of LTR copia-type

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr2
OG0000562
Physical Location & Seq
Reverse (-)
78450256 .. 78450904
649 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw2G050760.1

Sequence Viewer

Length: 324 bp
ATGAAAATGGAAGCACAACTGCTATGCTTGGAAAGTTTGCTAGTTTTTTGGCGAAATCAAACATGGCTTCTTCAGAGGATATACCAGGATCGAGTGTCCAAGGATAAGATTGGTGAAGGGTTCTTTCTAAATGGCTTGTACTACATATCAACTTCATCAAGCTTTTCAAAGTGTTTTCTAACAGAGTCCAAATCTGCAATACAGCAACAATTGTGGCATAAACGCCTAGCCCATCCTTCCTTTAATGTTTTGTCAATGTTATTCCCTAGTTTTTGTAAAGTCTCCCATAAGTGTGAGACATGTCATATGTCAAAAATTTACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00940 ko01110 map00940 map01110
Pfam Domains
Protein Families
Retrotran_gag_2

Protein Analysis

107

Amino Acids

12.64

Weight (kDa)

9.22

Isoelectric Point (pI)

50.95

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
gag_pre-integrs PF13976 45 - 105 1.4e-10 GAG-pre-integrase domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000562)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g17331 FvH4_3g36541
malus_domestica MD07G1078600.v1.1 MD10G1237700.v1.1 MD10G1333400.v1.1 MD11G1102200.v1.1 MD13G1138400.v1.1 MD14G1033400.v1.1 MD15G1053300.v1.1
prunus_persica Prupe.1G465400_v2.0.a1 Prupe.3G136000_v2.0.a1 Prupe.7G119900_v2.0.a1
pyrus_communis pycom01g04630 pycom03g13050 pycom04g21190 pycom05g04910 pycom05g05510 pycom08g15850 pycom09g15040 pycom1094g00010 pycom11g02000 pycom12g06150 pycom13g24110 pycom13g24910 pycom14g00050 pycom15g21970 pycom15g35170 pycom15g35180 pycom16g14620 pycom16g14630 pycom808g00110
rosa_chinensis RchiOBHm_Chr1g0322851 RchiOBHm_Chr1g0365941 RchiOBHm_Chr3g0453341 RchiOBHm_Chr4g0388371 RchiOBHm_Chr4g0394021 RchiOBHm_Chr5g0013181 RchiOBHm_Chr6g0261721 RchiOBHm_Chr6g0261731 RchiOBHm_Chr7g0188861 RchiOBHm_Chr7g0192331 RchiOBHm_Chr7g0231721
rosa_multiflora Rmu_sc0002521.1_g000006 Rmu_sc0003255.1_g000026 Rmu_sc0004191.1_g000036 Rmu_sc0004414.1_g000014 Rmu_sc0005670.1_g000006 Rmu_sc0006081.1_g000001 Rmu_sc0007215.1_g000004 Rmu_sc0010088.1_g000010 Rmu_sc0020285.1_g000003 Rmu_sc0026896.1_g000002 Rmu_ssc0000019.1_g000029
rosa_roxburghii Rroxscaffold_3G00224890 Rroxscaffold_6G00400640 Rroxscaffold_7G00176590 Rroxscaffold_7G00189230
rosa_samantha Rh4BG046700
rosa_wichuraiana Rw1G012690 Rw1G031370 Rw2G042180 Rw2G043670 Rw2G046240 Rw2G049890 Rw2G050760 Rw2G051280 Rw2G053590 Rw3G007590 Rw3G026850 Rw4G001540 Rw4G009760 Rw4G019270 Rw5G000720 Rw5G005620 Rw5G041560 Rw6G007370 Rw6G009830 Rw6G015360 Rw6G031160 Rw7G004930 Rw7G011010 Rw7G024230 Rw7G028240

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 96
AcsI RAATTY 1 cut(s) 315
AcuI CTGAAG 1 cut(s) 56
AfaI GTAC 1 cut(s) 140
AflIII ACRYGT 1 cut(s) 299
AgsI TTSAA 1 cut(s) 168
AjnI CCWGG 1 cut(s) 84
AluBI AGCT 1 cut(s) 162
AluI AGCT 1 cut(s) 162
Alw26I GTCTC 2 cut(s) 286, 290
AlwI GGATC 1 cut(s) 96
ApoI RAATTY 1 cut(s) 315
AsuHPI GGTGA 1 cut(s) 125
BccI CCATC 1 cut(s) 240
BciT130I CCWGG 1 cut(s) 86
BcoDI GTCTC 2 cut(s) 286, 290
BfaI CTAG 4 cut(s) 41, 227, 267, 322
Bme1390I CCNGG 1 cut(s) 86
BmrFI CCNGG 1 cut(s) 86
BsaJI CCNNGG 1 cut(s) 99
BseBI CCWGG 1 cut(s) 86
BseDI CCNNGG 1 cut(s) 99
BseGI GGATG 1 cut(s) 232
BsmAI GTCTC 2 cut(s) 286, 290
Bsp143I GATC 1 cut(s) 88
BspPI GGATC 1 cut(s) 96
BssECI CCNNGG 1 cut(s) 99
BssMI GATC 1 cut(s) 88
BssT1I CCWWGG 1 cut(s) 99
Bst2UI CCWGG 1 cut(s) 86
BstF5I GGATG 1 cut(s) 232
BstKTI GATC 1 cut(s) 91
BstMAI GTCTC 2 cut(s) 286, 290
BstMBI GATC 1 cut(s) 88
BstNI CCWGG 1 cut(s) 86
BstNSI RCATGY 1 cut(s) 303
BstSCI CCNGG 1 cut(s) 84
BtsCI GGATG 1 cut(s) 232
Csp6I GTAC 1 cut(s) 139
CspCI CAANNNNNGTGG 2 cut(s) 194, 229
CviAII CATG 2 cut(s) 63, 300
CviJI RGCY 4 cut(s) 67, 135, 162, 230
CviKI_1 RGCY 4 cut(s) 67, 135, 162, 230
CviQI GTAC 1 cut(s) 139
DpnI GATC 1 cut(s) 90
DpnII GATC 1 cut(s) 88
Eco130I CCWWGG 1 cut(s) 99
Eco57I CTGAAG 1 cut(s) 56
EcoRII CCWGG 1 cut(s) 84
EcoT14I CCWWGG 1 cut(s) 99
ErhI CCWWGG 1 cut(s) 99
FaeI CATG 2 cut(s) 66, 303
FaiI YATR 9 cut(s) 25, 64, 82, 146, 219, 288, 301, 306, 308
FatI CATG 2 cut(s) 62, 299
FauNDI CATATG 1 cut(s) 306
FokI GGATG 1 cut(s) 219
FspBI CTAG 4 cut(s) 41, 227, 267, 322
Hin1II CATG 2 cut(s) 66, 303
HindIII AAGCTT 1 cut(s) 160
HinfI GANTC 1 cut(s) 185
HphI GGTGA 1 cut(s) 125
Hpy188I TCNGA 1 cut(s) 75
HpyAV CCTTC 2 cut(s) 110, 246
HpyCH4V TGCA 1 cut(s) 197
Hsp92II CATG 2 cut(s) 66, 303
Kzo9I GATC 1 cut(s) 88
LpnPI CCDG 2 cut(s) 71, 98
MaeI CTAG 4 cut(s) 41, 227, 267, 322
MalI GATC 1 cut(s) 90
MboI GATC 1 cut(s) 88
MboII GAAGA 1 cut(s) 62
MfeI CAATTG 1 cut(s) 209
MluCI AATT 2 cut(s) 209, 315
MlyI GAGTC 1 cut(s) 194
MnlI CCTC 1 cut(s) 69
MseI TTAA 1 cut(s) 243
MslI CAYNNNNRTG 1 cut(s) 291
MspR9I CCNGG 1 cut(s) 86
MunI CAATTG 1 cut(s) 209
MvaI CCWGG 1 cut(s) 86
NdeI CATATG 1 cut(s) 306
NdeII GATC 1 cut(s) 88
NlaIII CATG 2 cut(s) 66, 303
NspI RCATGY 1 cut(s) 303
PciI ACATGT 1 cut(s) 299
PleI GAGTC 1 cut(s) 193
PpsI GAGTC 1 cut(s) 193
PscI ACATGT 1 cut(s) 299
Psp6I CCWGG 1 cut(s) 84
PspGI CCWGG 1 cut(s) 84
RsaI GTAC 1 cut(s) 140
RsaNI GTAC 1 cut(s) 139
RseI CAYNNNNRTG 1 cut(s) 291
SaqAI TTAA 1 cut(s) 243
Sau3AI GATC 1 cut(s) 88
SchI GAGTC 1 cut(s) 194
ScrFI CCNGG 1 cut(s) 86
SetI ASST 1 cut(s) 164
SmiMI CAYNNNNRTG 1 cut(s) 291
Sse9I AATT 2 cut(s) 209, 315
SspMI CTAG 4 cut(s) 41, 227, 267, 322
StyD4I CCNGG 1 cut(s) 84
StyI CCWWGG 1 cut(s) 99
TaqI TCGA 1 cut(s) 91
TasI AATT 2 cut(s) 209, 315
TatI WGTACW 1 cut(s) 138
Tru1I TTAA 1 cut(s) 243
Tru9I TTAA 1 cut(s) 243
TspDTI ATGAA 2 cut(s) 17, 144
XapI RAATTY 1 cut(s) 315
XceI RCATGY 1 cut(s) 303
XspI CTAG 4 cut(s) 41, 227, 267, 322
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.