RchiOBHm_Chr6g0261731

transposition, RNA-mediated

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Reverse (-)
16558831 .. 16559341
511 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ23471

Sequence Viewer

Length: 501 bp
ATGGCTGGAGAAATTTCTTCTAGTACTGATGACGTTAATCCTTTCAGTATCAATTCCAATCCAAACATGTCAAGTGTTTATGAAATTGAGGGTAATCCCAATCAATGTTTGAGTTCATTTTTATTAACTGAATACAATTATCTTCCTTGGTCTAGAGCTGTCACTTTGGCACTTGGAGGAAGATCAATGCTTGGATATGTCAATGGAGTTATACCAATGCCTGACATCAACTCCACCACTTATGATGCTTGGATTTGCAAAGATCAACTTGTCATGTCTTGGTTGCTCAACTCCATGGAGCCCAAGATTGCTGAAATTTTTAGCTACTCAGAATCATCCATGCACATGTGGAAGCATGTCAAAGAGATGTATGGAAACCAAAACAACTCTGCTCGTGTTTTTCATCTCAAGAAAGATATTGCTAGTCTCCAACAAGAGGAGAAGTCTTTTGTTCAATATCTTGGAAGCCTAACAAGTATGTGGAATGAGTTAGATGTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

166

Amino Acids

18.83

Weight (kDa)

4.72

Isoelectric Point (pI)

47.65

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Retrotran_gag_3 PF14244 36 - 74 1.2e-11 gag-polypeptide of LTR copia-type
Retrotran_gag_2 PF14223 57 - 165 1e-08 gag-polypeptide of LTR copia-type
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000562)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g17331 FvH4_3g36541
malus_domestica MD07G1078600.v1.1 MD10G1237700.v1.1 MD10G1333400.v1.1 MD11G1102200.v1.1 MD13G1138400.v1.1 MD14G1033400.v1.1 MD15G1053300.v1.1
prunus_persica Prupe.1G465400_v2.0.a1 Prupe.3G136000_v2.0.a1 Prupe.7G119900_v2.0.a1
pyrus_communis pycom01g04630 pycom03g13050 pycom04g21190 pycom05g04910 pycom05g05510 pycom08g15850 pycom09g15040 pycom1094g00010 pycom11g02000 pycom12g06150 pycom13g24110 pycom13g24910 pycom14g00050 pycom15g21970 pycom15g35170 pycom15g35180 pycom16g14620 pycom16g14630 pycom808g00110
rosa_chinensis RchiOBHm_Chr1g0322851 RchiOBHm_Chr1g0365941 RchiOBHm_Chr3g0453341 RchiOBHm_Chr4g0388371 RchiOBHm_Chr4g0394021 RchiOBHm_Chr5g0013181 RchiOBHm_Chr6g0261721 RchiOBHm_Chr6g0261731 RchiOBHm_Chr7g0188861 RchiOBHm_Chr7g0192331 RchiOBHm_Chr7g0231721
rosa_multiflora Rmu_sc0002521.1_g000006 Rmu_sc0003255.1_g000026 Rmu_sc0004191.1_g000036 Rmu_sc0004414.1_g000014 Rmu_sc0005670.1_g000006 Rmu_sc0006081.1_g000001 Rmu_sc0007215.1_g000004 Rmu_sc0010088.1_g000010 Rmu_sc0020285.1_g000003 Rmu_sc0026896.1_g000002 Rmu_ssc0000019.1_g000029
rosa_roxburghii Rroxscaffold_3G00224890 Rroxscaffold_6G00400640 Rroxscaffold_7G00176590 Rroxscaffold_7G00189230
rosa_samantha Rh4BG046700
rosa_wichuraiana Rw1G012690 Rw1G031370 Rw2G042180 Rw2G043670 Rw2G046240 Rw2G049890 Rw2G050760 Rw2G051280 Rw2G053590 Rw3G007590 Rw3G026850 Rw4G001540 Rw4G009760 Rw4G019270 Rw5G000720 Rw5G005620 Rw5G041560 Rw6G007370 Rw6G009830 Rw6G015360 Rw6G031160 Rw7G004930 Rw7G011010 Rw7G024230 Rw7G028240

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 12, 315
AfaI GTAC 1 cut(s) 25
AfiI CCNNNNNNNGG 1 cut(s) 436
AflIII ACRYGT 2 cut(s) 66, 345
AgsI TTSAA 1 cut(s) 455
AluBI AGCT 2 cut(s) 158, 324
AluI AGCT 2 cut(s) 158, 324
Alw26I GTCTC 1 cut(s) 431
ApoI RAATTY 2 cut(s) 12, 315
BanII GRGCYC 1 cut(s) 303
BauI CACGAG 1 cut(s) 393
BcoDI GTCTC 1 cut(s) 431
BfaI CTAG 3 cut(s) 21, 153, 423
BmcAI AGTACT 1 cut(s) 25
BmiI GGNNCC 1 cut(s) 300
BmsI GCATC 1 cut(s) 235
BpmI CTGGAG 1 cut(s) 27
BpuEI CTTGAG 1 cut(s) 392
BsaJI CCNNGG 2 cut(s) 146, 294
BsaXI ACNNNNNCTCC 2 cut(s) 215, 245
Bsc4I CCNNNNNNNGG 1 cut(s) 436
BseDI CCNNGG 2 cut(s) 146, 294
BseGI GGATG 1 cut(s) 335
BseLI CCNNNNNNNGG 1 cut(s) 436
BseMII CTCAG 1 cut(s) 342
BseRI GAGGAG 1 cut(s) 452
BslI CCNNNNNNNGG 1 cut(s) 436
BsmAI GTCTC 1 cut(s) 431
Bsp1286I GDGCHC 1 cut(s) 303
Bsp143I GATC 2 cut(s) 182, 262
Bsp19I CCATGG 1 cut(s) 294
BspCNI CTCAG 1 cut(s) 341
BspLI GGNNCC 1 cut(s) 300
BssECI CCNNGG 2 cut(s) 146, 294
BssMI GATC 2 cut(s) 182, 262
BssSI CACGAG 1 cut(s) 393
BssT1I CCWWGG 2 cut(s) 146, 294
Bst2BI CACGAG 1 cut(s) 393
BstDEI CTNAG 1 cut(s) 328
BstDSI CCRYGG 1 cut(s) 294
BstF5I GGATG 1 cut(s) 335
BstKTI GATC 2 cut(s) 185, 265
BstMAI GTCTC 1 cut(s) 431
BstMBI GATC 2 cut(s) 182, 262
BstNSI RCATGY 3 cut(s) 70, 349, 359
BtgI CCRYGG 1 cut(s) 294
BtsCI GGATG 1 cut(s) 335
Csp6I GTAC 1 cut(s) 24
CviAII CATG 6 cut(s) 67, 274, 295, 340, 346, 356
CviJI RGCY 5 cut(s) 5, 158, 301, 324, 468
CviKI_1 RGCY 5 cut(s) 5, 158, 301, 324, 468
CviQI GTAC 1 cut(s) 24
DdeI CTNAG 1 cut(s) 328
DpnI GATC 2 cut(s) 184, 264
DpnII GATC 2 cut(s) 182, 262
Eco130I CCWWGG 2 cut(s) 146, 294
Eco24I GRGCYC 1 cut(s) 303
EcoT14I CCWWGG 2 cut(s) 146, 294
EcoT38I GRGCYC 1 cut(s) 303
ErhI CCWWGG 2 cut(s) 146, 294
FaeI CATG 6 cut(s) 70, 277, 298, 343, 349, 359
FalI AAGNNNNNCTT 2 cut(s) 252, 284
FatI CATG 6 cut(s) 66, 273, 294, 339, 345, 355
FokI GGATG 1 cut(s) 322
FriOI GRGCYC 1 cut(s) 303
FspBI CTAG 3 cut(s) 21, 153, 423
GsuI CTGGAG 1 cut(s) 27
Hin1II CATG 6 cut(s) 70, 277, 298, 343, 349, 359
HinfI GANTC 1 cut(s) 332
Hpy188I TCNGA 1 cut(s) 331
Hpy188III TCNNGA 2 cut(s) 153, 409
HpyCH4IV ACGT 1 cut(s) 33
HpyCH4V TGCA 2 cut(s) 258, 343
HpyF3I CTNAG 1 cut(s) 328
HpySE526I ACGT 1 cut(s) 33
Hsp92II CATG 6 cut(s) 70, 277, 298, 343, 349, 359
Kzo9I GATC 2 cut(s) 182, 262
LmnI GCTCC 1 cut(s) 298
LpnPI CCDG 1 cut(s) 234
LweI GCATC 1 cut(s) 235
MaeI CTAG 3 cut(s) 21, 153, 423
MaeII ACGT 1 cut(s) 33
MaeIII GTNAC 1 cut(s) 160
MalI GATC 2 cut(s) 184, 264
MboI GATC 2 cut(s) 182, 262
MboII GAAGA 3 cut(s) 9, 134, 192
MhlI GDGCHC 1 cut(s) 303
MluCI AATT 5 cut(s) 12, 52, 84, 136, 315
MmeI TCCRAC 1 cut(s) 454
MnlI CCTC 3 cut(s) 82, 170, 430
MseI TTAA 2 cut(s) 36, 125
MslI CAYNNNNRTG 1 cut(s) 344
NcoI CCATGG 1 cut(s) 294
NdeII GATC 2 cut(s) 182, 262
NlaIII CATG 6 cut(s) 70, 277, 298, 343, 349, 359
NlaIV GGNNCC 1 cut(s) 300
NmuCI GTSAC 1 cut(s) 160
NspI RCATGY 3 cut(s) 70, 349, 359
PciI ACATGT 2 cut(s) 66, 345
PfeI GAWTC 1 cut(s) 332
PscI ACATGT 2 cut(s) 66, 345
PspN4I GGNNCC 1 cut(s) 300
RsaI GTAC 1 cut(s) 25
RsaNI GTAC 1 cut(s) 24
RseI CAYNNNNRTG 1 cut(s) 344
SaqAI TTAA 2 cut(s) 36, 125
Sau3AI GATC 2 cut(s) 182, 262
ScaI AGTACT 1 cut(s) 25
SduI GDGCHC 1 cut(s) 303
SetI ASST 3 cut(s) 36, 160, 326
SfaNI GCATC 1 cut(s) 235
SmiMI CAYNNNNRTG 1 cut(s) 344
SmlI CTYRAG 1 cut(s) 407
SmoI CTYRAG 1 cut(s) 407
Sse9I AATT 5 cut(s) 12, 52, 84, 136, 315
SspMI CTAG 3 cut(s) 21, 153, 423
StyI CCWWGG 2 cut(s) 146, 294
TaiI ACGT 1 cut(s) 36
TasI AATT 5 cut(s) 12, 52, 84, 136, 315
TatI WGTACW 1 cut(s) 23
TfiI GAWTC 1 cut(s) 332
Tru1I TTAA 2 cut(s) 36, 125
Tru9I TTAA 2 cut(s) 36, 125
TseFI GTSAC 1 cut(s) 160
Tsp45I GTSAC 1 cut(s) 160
TspDTI ATGAA 3 cut(s) 96, 105, 392
XapI RAATTY 2 cut(s) 12, 315
XbaI TCTAGA 1 cut(s) 152
XceI RCATGY 3 cut(s) 70, 349, 359
XspI CTAG 3 cut(s) 21, 153, 423
ZrmI AGTACT 1 cut(s) 25
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.