pycom09g15040

transposition, RNA-mediated

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr9
Physical Location & Seq
Reverse (-)
14932294 .. 14932637
344 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom09g15040.1

Sequence Viewer

Length: 300 bp
ATGAACATGAGTACAATGCCAAATGTACCAGAATCTAGGGCATATGTAACCAACGAAAGAAGATACAAAGGAAAGCACCCTCACCTAAAGTGTCAACACTGCAATAATACAGGCCATGTTAAGGATACTTGCTGGATTTTACATCCAGAGTTAAAGCCTGACTTCATGAAGGGTGTACAAAGGATGAATCGTGCTCCACATCGAGCAAATCATGCATCCACCTCCATCCCCAACAAGTCAGATTCATTGAAGAACTTCACAGCAAATCCAACAGAACTCATGAATGAACAGTACTCCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

100

Amino Acids

11.45

Weight (kDa)

9.51

Isoelectric Point (pI)

30.12

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000562)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g17331 FvH4_3g36541
malus_domestica MD07G1078600.v1.1 MD10G1237700.v1.1 MD10G1333400.v1.1 MD11G1102200.v1.1 MD13G1138400.v1.1 MD14G1033400.v1.1 MD15G1053300.v1.1
prunus_persica Prupe.1G465400_v2.0.a1 Prupe.3G136000_v2.0.a1 Prupe.7G119900_v2.0.a1
pyrus_communis pycom01g04630 pycom03g13050 pycom04g21190 pycom05g04910 pycom05g05510 pycom08g15850 pycom09g15040 pycom1094g00010 pycom11g02000 pycom12g06150 pycom13g24110 pycom13g24910 pycom14g00050 pycom15g21970 pycom15g35170 pycom15g35180 pycom16g14620 pycom16g14630 pycom808g00110
rosa_chinensis RchiOBHm_Chr1g0322851 RchiOBHm_Chr1g0365941 RchiOBHm_Chr3g0453341 RchiOBHm_Chr4g0388371 RchiOBHm_Chr4g0394021 RchiOBHm_Chr5g0013181 RchiOBHm_Chr6g0261721 RchiOBHm_Chr6g0261731 RchiOBHm_Chr7g0188861 RchiOBHm_Chr7g0192331 RchiOBHm_Chr7g0231721
rosa_multiflora Rmu_sc0002521.1_g000006 Rmu_sc0003255.1_g000026 Rmu_sc0004191.1_g000036 Rmu_sc0004414.1_g000014 Rmu_sc0005670.1_g000006 Rmu_sc0006081.1_g000001 Rmu_sc0007215.1_g000004 Rmu_sc0010088.1_g000010 Rmu_sc0020285.1_g000003 Rmu_sc0026896.1_g000002 Rmu_ssc0000019.1_g000029
rosa_roxburghii Rroxscaffold_3G00224890 Rroxscaffold_6G00400640 Rroxscaffold_7G00176590 Rroxscaffold_7G00189230
rosa_samantha Rh4BG046700
rosa_wichuraiana Rw1G012690 Rw1G031370 Rw2G042180 Rw2G043670 Rw2G046240 Rw2G049890 Rw2G050760 Rw2G051280 Rw2G053590 Rw3G007590 Rw3G026850 Rw4G001540 Rw4G009760 Rw4G019270 Rw5G000720 Rw5G005620 Rw5G041560 Rw6G007370 Rw6G009830 Rw6G015360 Rw6G031160 Rw7G004930 Rw7G011010 Rw7G024230 Rw7G028240

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 4 cut(s) 13, 27, 177, 293
AfiI CCNNNNNNNGG 1 cut(s) 121
AgsI TTSAA 1 cut(s) 250
Alw21I GWGCWC 1 cut(s) 196
AoxI GGCC 1 cut(s) 112
Asp700I GAANNNNTTC 1 cut(s) 254
AsuHPI GGTGA 1 cut(s) 74
Bbv12I GWGCWC 1 cut(s) 196
BccI CCATC 1 cut(s) 233
BciVI GTATCC 1 cut(s) 118
BfaI CTAG 1 cut(s) 36
BfuI GTATCC 1 cut(s) 118
BmcAI AGTACT 1 cut(s) 293
BmsI GCATC 1 cut(s) 224
Bsc4I CCNNNNNNNGG 1 cut(s) 121
BseGI GGATG 4 cut(s) 142, 189, 215, 225
BseLI CCNNNNNNNGG 1 cut(s) 121
BshFI GGCC 1 cut(s) 114
BsiHKAI GWGCWC 1 cut(s) 196
BslI CCNNNNNNNGG 1 cut(s) 121
BsnI GGCC 1 cut(s) 114
Bsp1286I GDGCHC 1 cut(s) 196
Bsp1407I TGTACA 1 cut(s) 175
BspANI GGCC 1 cut(s) 114
BspHI TCATGA 2 cut(s) 165, 279
BsrGI TGTACA 1 cut(s) 175
Bst4CI ACNGT 1 cut(s) 291
BstAPI GCANNNNNTGC 1 cut(s) 212
BstAUI TGTACA 1 cut(s) 175
BstF5I GGATG 4 cut(s) 142, 189, 215, 225
BstMWI GCNNNNNNNGC 1 cut(s) 212
BsuI GTATCC 1 cut(s) 118
BsuRI GGCC 1 cut(s) 114
BtsCI GGATG 4 cut(s) 142, 189, 215, 225
BtsI GCAGTG 1 cut(s) 97
BtsIMutI CAGTG 1 cut(s) 97
CciI TCATGA 2 cut(s) 165, 279
Csp6I GTAC 4 cut(s) 12, 26, 176, 292
CviAII CATG 5 cut(s) 7, 116, 166, 212, 280
CviJI RGCY 2 cut(s) 114, 157
CviKI_1 RGCY 2 cut(s) 114, 157
CviQI GTAC 4 cut(s) 12, 26, 176, 292
EcoT22I ATGCAT 1 cut(s) 217
FaeI CATG 5 cut(s) 10, 119, 169, 215, 283
FaiI YATR 7 cut(s) 8, 43, 45, 117, 167, 213, 281
FalI AAGNNNNNCTT 2 cut(s) 146, 178
FatI CATG 5 cut(s) 6, 115, 165, 211, 279
FauNDI CATATG 1 cut(s) 43
FokI GGATG 4 cut(s) 129, 196, 202, 212
FspBI CTAG 1 cut(s) 36
HaeIII GGCC 1 cut(s) 114
Hin1II CATG 5 cut(s) 10, 119, 169, 215, 283
HincII GTYRAC 1 cut(s) 95
HindII GTYRAC 1 cut(s) 95
HinfI GANTC 3 cut(s) 32, 187, 242
HphI GGTGA 1 cut(s) 74
Hpy166II GTNNAC 2 cut(s) 95, 176
Hpy188I TCNGA 1 cut(s) 241
Hpy188III TCNNGA 3 cut(s) 146, 166, 280
Hpy8I GTNNAC 2 cut(s) 95, 176
HpyAV CCTTC 1 cut(s) 163
HpyCH4III ACNGT 1 cut(s) 291
HpyCH4V TGCA 2 cut(s) 102, 215
HpyF10VI GCNNNNNNNGC 1 cut(s) 212
Hsp92II CATG 5 cut(s) 10, 119, 169, 215, 283
LmnI GCTCC 1 cut(s) 199
LpnPI CCDG 5 cut(s) 42, 96, 118, 159, 171
LweI GCATC 1 cut(s) 224
MaeI CTAG 1 cut(s) 36
MaeIII GTNAC 1 cut(s) 46
MboII GAAGA 2 cut(s) 72, 262
MhlI GDGCHC 1 cut(s) 196
MmeI TCCRAC 1 cut(s) 293
MnlI CCTC 2 cut(s) 90, 232
Mph1103I ATGCAT 1 cut(s) 217
MroXI GAANNNNTTC 1 cut(s) 254
MseI TTAA 2 cut(s) 120, 152
MwoI GCNNNNNNNGC 1 cut(s) 212
NdeI CATATG 1 cut(s) 43
NlaIII CATG 5 cut(s) 10, 119, 169, 215, 283
NsiI ATGCAT 1 cut(s) 217
PagI TCATGA 2 cut(s) 165, 279
PdmI GAANNNNTTC 1 cut(s) 254
PfeI GAWTC 3 cut(s) 32, 187, 242
RsaI GTAC 4 cut(s) 13, 27, 177, 293
RsaNI GTAC 4 cut(s) 12, 26, 176, 292
SaqAI TTAA 2 cut(s) 120, 152
ScaI AGTACT 1 cut(s) 293
SduI GDGCHC 1 cut(s) 196
SetI ASST 2 cut(s) 87, 224
SfaNI GCATC 1 cut(s) 224
SspMI CTAG 1 cut(s) 36
TaaI ACNGT 1 cut(s) 291
TaqI TCGA 1 cut(s) 202
TatI WGTACW 3 cut(s) 11, 175, 291
TfiI GAWTC 3 cut(s) 32, 187, 242
Tru1I TTAA 2 cut(s) 120, 152
Tru9I TTAA 2 cut(s) 120, 152
TscAI CASTG 1 cut(s) 104
TspDTI ATGAA 7 cut(s) 17, 154, 182, 200, 234, 296, 300
TspRI CASTG 1 cut(s) 104
XmnI GAANNNNTTC 1 cut(s) 254
XspI CTAG 1 cut(s) 36
ZrmI AGTACT 1 cut(s) 293
Zsp2I ATGCAT 1 cut(s) 217
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.