Rroxscaffold_6G00400640

transposition, RNA-mediated

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000006
OG0000562
Physical Location & Seq
Reverse (-)
22716672 .. 22717520
849 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_6G00400640.1

Sequence Viewer

Length: 339 bp
ATGTCAATGGAGTTATACCAATGCCCGACATCAACTCCACCACTTATGATGCTTGGCTTTGCAAAGATCAACTTGTCATGTCTTGGTTGCTCAACTCTATGGAGCCCAAGATTGCAGAAAGAAATTTTTAGCTACTCGAATCATCCATGCACTGTGGAAGCATGTCAAAGAGATGTATGGAAACCAAAACAACTCGCTCGTGTTTTTCAACTCAAGAAAGATATTGCTAGTCTCCAACAAGAGGAGAAGTCTTTTGTTCAATATCTTGGAAGCCTAACAAGTATGTGGAATGAGTTAGATGTATATCGACCTCATACCACGATGCTAATGTCCTATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Retrotran_gag_2 rve

Protein Analysis

112

Amino Acids

13.01

Weight (kDa)

8.3

Isoelectric Point (pI)

48.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000562)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g17331 FvH4_3g36541
malus_domestica MD07G1078600.v1.1 MD10G1237700.v1.1 MD10G1333400.v1.1 MD11G1102200.v1.1 MD13G1138400.v1.1 MD14G1033400.v1.1 MD15G1053300.v1.1
prunus_persica Prupe.1G465400_v2.0.a1 Prupe.3G136000_v2.0.a1 Prupe.7G119900_v2.0.a1
pyrus_communis pycom01g04630 pycom03g13050 pycom04g21190 pycom05g04910 pycom05g05510 pycom08g15850 pycom09g15040 pycom1094g00010 pycom11g02000 pycom12g06150 pycom13g24110 pycom13g24910 pycom14g00050 pycom15g21970 pycom15g35170 pycom15g35180 pycom16g14620 pycom16g14630 pycom808g00110
rosa_chinensis RchiOBHm_Chr1g0322851 RchiOBHm_Chr1g0365941 RchiOBHm_Chr3g0453341 RchiOBHm_Chr4g0388371 RchiOBHm_Chr4g0394021 RchiOBHm_Chr5g0013181 RchiOBHm_Chr6g0261721 RchiOBHm_Chr6g0261731 RchiOBHm_Chr7g0188861 RchiOBHm_Chr7g0192331 RchiOBHm_Chr7g0231721
rosa_multiflora Rmu_sc0002521.1_g000006 Rmu_sc0003255.1_g000026 Rmu_sc0004191.1_g000036 Rmu_sc0004414.1_g000014 Rmu_sc0005670.1_g000006 Rmu_sc0006081.1_g000001 Rmu_sc0007215.1_g000004 Rmu_sc0010088.1_g000010 Rmu_sc0020285.1_g000003 Rmu_sc0026896.1_g000002 Rmu_ssc0000019.1_g000029
rosa_roxburghii Rroxscaffold_3G00224890 Rroxscaffold_6G00400640 Rroxscaffold_7G00176590 Rroxscaffold_7G00189230
rosa_samantha Rh4BG046700
rosa_wichuraiana Rw1G012690 Rw1G031370 Rw2G042180 Rw2G043670 Rw2G046240 Rw2G049890 Rw2G050760 Rw2G051280 Rw2G053590 Rw3G007590 Rw3G026850 Rw4G001540 Rw4G009760 Rw4G019270 Rw5G000720 Rw5G005620 Rw5G041560 Rw6G007370 Rw6G009830 Rw6G015360 Rw6G031160 Rw7G004930 Rw7G011010 Rw7G024230 Rw7G028240

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 123
AfiI CCNNNNNNNGG 1 cut(s) 241
AgsI TTSAA 2 cut(s) 209, 260
AluBI AGCT 1 cut(s) 132
AluI AGCT 1 cut(s) 132
Alw26I GTCTC 1 cut(s) 236
ApoI RAATTY 1 cut(s) 123
BanII GRGCYC 1 cut(s) 107
BauI CACGAG 1 cut(s) 198
BcoDI GTCTC 1 cut(s) 236
BfaI CTAG 1 cut(s) 228
BmiI GGNNCC 1 cut(s) 104
BmsI GCATC 2 cut(s) 39, 312
BpuEI CTTGAG 1 cut(s) 197
BsaBI GATNNNNATC 1 cut(s) 303
BsaXI ACNNNNNCTCC 2 cut(s) 19, 49
Bsc4I CCNNNNNNNGG 1 cut(s) 241
Bse8I GATNNNNATC 1 cut(s) 303
BseGI GGATG 1 cut(s) 142
BseJI GATNNNNATC 1 cut(s) 303
BseLI CCNNNNNNNGG 1 cut(s) 241
BseRI GAGGAG 1 cut(s) 257
BslI CCNNNNNNNGG 1 cut(s) 241
BsmAI GTCTC 1 cut(s) 236
Bsp1286I GDGCHC 1 cut(s) 107
Bsp143I GATC 1 cut(s) 66
BspLI GGNNCC 1 cut(s) 104
BssMI GATC 1 cut(s) 66
BssSI CACGAG 1 cut(s) 198
Bst2BI CACGAG 1 cut(s) 198
Bst4CI ACNGT 1 cut(s) 154
BstF5I GGATG 1 cut(s) 142
BstKTI GATC 1 cut(s) 69
BstMAI GTCTC 1 cut(s) 236
BstMBI GATC 1 cut(s) 66
BstNSI RCATGY 1 cut(s) 165
BtsCI GGATG 1 cut(s) 142
BtsIMutI CAGTG 1 cut(s) 150
CviAII CATG 3 cut(s) 78, 147, 162
CviJI RGCY 4 cut(s) 57, 105, 132, 273
CviKI_1 RGCY 4 cut(s) 57, 105, 132, 273
DpnI GATC 1 cut(s) 68
DpnII GATC 1 cut(s) 66
Eco24I GRGCYC 1 cut(s) 107
EcoT38I GRGCYC 1 cut(s) 107
FaeI CATG 3 cut(s) 81, 150, 165
FalI AAGNNNNNCTT 2 cut(s) 56, 88
FatI CATG 3 cut(s) 77, 146, 161
FokI GGATG 1 cut(s) 129
FriOI GRGCYC 1 cut(s) 107
FspBI CTAG 1 cut(s) 228
Hin1II CATG 3 cut(s) 81, 150, 165
HinfI GANTC 1 cut(s) 139
Hpy188III TCNNGA 1 cut(s) 214
HpyCH4III ACNGT 1 cut(s) 154
HpyCH4V TGCA 3 cut(s) 62, 115, 150
Hsp92II CATG 3 cut(s) 81, 150, 165
Kzo9I GATC 1 cut(s) 66
LmnI GCTCC 1 cut(s) 102
LweI GCATC 2 cut(s) 39, 312
MaeI CTAG 1 cut(s) 228
MalI GATC 1 cut(s) 68
MboI GATC 1 cut(s) 66
MhlI GDGCHC 1 cut(s) 107
MluCI AATT 1 cut(s) 123
MmeI TCCRAC 1 cut(s) 259
MnlI CCTC 2 cut(s) 235, 321
NdeII GATC 1 cut(s) 66
NlaIII CATG 3 cut(s) 81, 150, 165
NlaIV GGNNCC 1 cut(s) 104
NspI RCATGY 1 cut(s) 165
PfeI GAWTC 1 cut(s) 139
PspN4I GGNNCC 1 cut(s) 104
Sau3AI GATC 1 cut(s) 66
SduI GDGCHC 1 cut(s) 107
SetI ASST 2 cut(s) 134, 313
SfaNI GCATC 2 cut(s) 39, 312
SmlI CTYRAG 1 cut(s) 212
SmoI CTYRAG 1 cut(s) 212
Sse9I AATT 1 cut(s) 123
SspMI CTAG 1 cut(s) 228
TaaI ACNGT 1 cut(s) 154
TaqI TCGA 2 cut(s) 137, 307
TasI AATT 1 cut(s) 123
TfiI GAWTC 1 cut(s) 139
TscAI CASTG 1 cut(s) 157
TspRI CASTG 1 cut(s) 157
XapI RAATTY 1 cut(s) 123
XceI RCATGY 1 cut(s) 165
XspI CTAG 1 cut(s) 228
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.