Rmu_sc0004414.1_g000014

transposition, RNA-mediated

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004414.1
OG0000562
Physical Location & Seq
Reverse (-)
46141 .. 46716
576 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004414.1_g000014.1.cds

Sequence Viewer

Length: 576 bp
atgcatctctggaatcatgtcaaagagatgtatggaaatcagaataatgctgctcgagtttttcaactcaaacgagatattgctgatcttcaacaagaaggtaagccctttgttcaacatcttggtagccttacaagtatgtggaatgaactagatatttatagacctcatactactgaggctagtgttttgttaaaaagagcagaggaggacaagatttttcagctccttgcaagcttaagttcagaatatgaagatttgagaagtcattttcttatgaatactgagcttccatctttcaacaatgtgtgtgccactattcgaagagaagaagttcgaaaaaaggtgatgaatatggagaccaagacaagtgcatctgaaactagagcttatgcttctaatcacaggcaagctaatcacaggcaagctgaagctaaagtgtacaaaggcaagagacctgacttgaaatgcacctactatgagggtgttggacatgtcagggatatatgttgggttctctatccagagcagaagccaaagtttctaaaggaaggcaaaagctctcaaaagagctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Retrotran_gag_2 Retrotran_gag_3 Retrotrans_gag rve

Protein Analysis

191

Amino Acids

22.32

Weight (kDa)

9.17

Isoelectric Point (pI)

46.08

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000562)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g17331 FvH4_3g36541
malus_domestica MD07G1078600.v1.1 MD10G1237700.v1.1 MD10G1333400.v1.1 MD11G1102200.v1.1 MD13G1138400.v1.1 MD14G1033400.v1.1 MD15G1053300.v1.1
prunus_persica Prupe.1G465400_v2.0.a1 Prupe.3G136000_v2.0.a1 Prupe.7G119900_v2.0.a1
pyrus_communis pycom01g04630 pycom03g13050 pycom04g21190 pycom05g04910 pycom05g05510 pycom08g15850 pycom09g15040 pycom1094g00010 pycom11g02000 pycom12g06150 pycom13g24110 pycom13g24910 pycom14g00050 pycom15g21970 pycom15g35170 pycom15g35180 pycom16g14620 pycom16g14630 pycom808g00110
rosa_chinensis RchiOBHm_Chr1g0322851 RchiOBHm_Chr1g0365941 RchiOBHm_Chr3g0453341 RchiOBHm_Chr4g0388371 RchiOBHm_Chr4g0394021 RchiOBHm_Chr5g0013181 RchiOBHm_Chr6g0261721 RchiOBHm_Chr6g0261731 RchiOBHm_Chr7g0188861 RchiOBHm_Chr7g0192331 RchiOBHm_Chr7g0231721
rosa_multiflora Rmu_sc0002521.1_g000006 Rmu_sc0003255.1_g000026 Rmu_sc0004191.1_g000036 Rmu_sc0004414.1_g000014 Rmu_sc0005670.1_g000006 Rmu_sc0006081.1_g000001 Rmu_sc0007215.1_g000004 Rmu_sc0010088.1_g000010 Rmu_sc0020285.1_g000003 Rmu_sc0026896.1_g000002 Rmu_ssc0000019.1_g000029
rosa_roxburghii Rroxscaffold_3G00224890 Rroxscaffold_6G00400640 Rroxscaffold_7G00176590 Rroxscaffold_7G00189230
rosa_samantha Rh4BG046700
rosa_wichuraiana Rw1G012690 Rw1G031370 Rw2G042180 Rw2G043670 Rw2G046240 Rw2G049890 Rw2G050760 Rw2G051280 Rw2G053590 Rw3G007590 Rw3G026850 Rw4G001540 Rw4G009760 Rw4G019270 Rw5G000720 Rw5G005620 Rw5G041560 Rw6G007370 Rw6G009830 Rw6G015360 Rw6G031160 Rw7G004930 Rw7G011010 Rw7G024230 Rw7G028240

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 450
AfaI GTAC 1 cut(s) 443
AflII CTTAAG 1 cut(s) 238
AflIII ACRYGT 1 cut(s) 493
AgsI TTSAA 5 cut(s) 65, 92, 116, 301, 466
AluBI AGCT 9 cut(s) 226, 237, 289, 389, 413, 428, 434, 561, 573
AluI AGCT 9 cut(s) 226, 237, 289, 389, 413, 428, 434, 561, 573
Alw26I GTCTC 2 cut(s) 353, 448
Ama87I CYCGRG 1 cut(s) 54
ApeKI GCWGC 1 cut(s) 50
Asp700I GAANNNNTTC 1 cut(s) 333
AsuHPI GGTGA 1 cut(s) 358
AsuII TTCGAA 2 cut(s) 322, 337
AvaI CYCGRG 1 cut(s) 54
BbvI GCAGC 1 cut(s) 37
BccI CCATC 1 cut(s) 301
BcoDI GTCTC 2 cut(s) 353, 448
BfaI CTAG 4 cut(s) 152, 183, 384, 574
BfrI CTTAAG 1 cut(s) 238
BisI GCNGC 1 cut(s) 51
BlsI GCNGC 1 cut(s) 52
BmeT110I CYCGRG 1 cut(s) 54
BmsI GCATC 2 cut(s) 13, 383
Bpu14I TTCGAA 2 cut(s) 322, 337
BsaI GGTCTC 2 cut(s) 353, 448
BseMII CTCAG 2 cut(s) 168, 276
BseRI GAGGAG 1 cut(s) 221
BseXI GCAGC 1 cut(s) 37
BsiHKCI CYCGRG 1 cut(s) 54
BsmAI GTCTC 2 cut(s) 353, 448
Bso31I GGTCTC 2 cut(s) 353, 448
BsoBI CYCGRG 1 cut(s) 54
Bsp119I TTCGAA 2 cut(s) 322, 337
Bsp1407I TGTACA 1 cut(s) 441
Bsp143I GATC 1 cut(s) 85
BspCNI CTCAG 2 cut(s) 169, 277
BspT104I TTCGAA 2 cut(s) 322, 337
BspTI CTTAAG 1 cut(s) 238
BspTNI GGTCTC 2 cut(s) 353, 448
BsrGI TGTACA 1 cut(s) 441
BssMI GATC 1 cut(s) 85
Bst6I CTCTTC 1 cut(s) 319
BstAFI CTTAAG 1 cut(s) 238
BstAUI TGTACA 1 cut(s) 441
BstBI TTCGAA 2 cut(s) 322, 337
BstC8I GCNNGC 3 cut(s) 235, 411, 426
BstDEI CTNAG 2 cut(s) 177, 285
BstKTI GATC 1 cut(s) 88
BstMAI GTCTC 2 cut(s) 353, 448
BstMBI GATC 1 cut(s) 85
BstNSI RCATGY 1 cut(s) 497
BstV1I GCAGC 1 cut(s) 37
Cac8I GCNNGC 3 cut(s) 235, 411, 426
Csp6I GTAC 1 cut(s) 442
CviAII CATG 2 cut(s) 17, 494
CviQI GTAC 1 cut(s) 442
DdeI CTNAG 2 cut(s) 177, 285
DpnI GATC 1 cut(s) 87
DpnII GATC 1 cut(s) 85
Eam1104I CTCTTC 1 cut(s) 319
EarI CTCTTC 1 cut(s) 319
Eco31I GGTCTC 2 cut(s) 353, 448
Eco57I CTGAAG 1 cut(s) 450
Eco88I CYCGRG 1 cut(s) 54
EcoT22I ATGCAT 1 cut(s) 6
FaeI CATG 2 cut(s) 20, 497
FatI CATG 2 cut(s) 16, 493
Fnu4HI GCNGC 1 cut(s) 51
Fsp4HI GCNGC 1 cut(s) 51
FspBI CTAG 4 cut(s) 152, 183, 384, 574
GluI GCNGC 1 cut(s) 51
Hin1II CATG 2 cut(s) 20, 497
HindIII AAGCTT 1 cut(s) 235
HinfI GANTC 1 cut(s) 13
HphI GGTGA 1 cut(s) 358
Hpy166II GTNNAC 1 cut(s) 442
Hpy188I TCNGA 3 cut(s) 42, 247, 379
Hpy188III TCNNGA 2 cut(s) 10, 524
Hpy8I GTNNAC 1 cut(s) 442
HpyAV CCTTC 2 cut(s) 92, 545
HpyCH4V TGCA 4 cut(s) 4, 233, 374, 471
HpyF3I CTNAG 2 cut(s) 177, 285
Hsp92II CATG 2 cut(s) 20, 497
Kzo9I GATC 1 cut(s) 85
LmnI GCTCC 1 cut(s) 231
LpnPI CCDG 5 cut(s) 391, 406, 471, 484, 537
Lsp1109I GCAGC 1 cut(s) 37
LweI GCATC 2 cut(s) 13, 383
MaeI CTAG 4 cut(s) 152, 183, 384, 574
MalI GATC 1 cut(s) 87
MboI GATC 1 cut(s) 85
MboII GAAGA 4 cut(s) 80, 266, 336, 341
MmeI TCCRAC 1 cut(s) 469
MnlI CCTC 5 cut(s) 172, 177, 199, 202, 475
Mph1103I ATGCAT 1 cut(s) 6
MroXI GAANNNNTTC 1 cut(s) 333
MseI TTAA 2 cut(s) 194, 239
MspCI CTTAAG 1 cut(s) 238
NdeII GATC 1 cut(s) 85
NlaIII CATG 2 cut(s) 20, 497
NsiI ATGCAT 1 cut(s) 6
NspI RCATGY 1 cut(s) 497
NspV TTCGAA 2 cut(s) 322, 337
PaeR7I CTCGAG 1 cut(s) 54
PciI ACATGT 1 cut(s) 493
PdmI GAANNNNTTC 1 cut(s) 333
PfeI GAWTC 1 cut(s) 13
PkrI GCNGC 1 cut(s) 52
PscI ACATGT 1 cut(s) 493
PspXI VCTCGAGB 1 cut(s) 54
RsaI GTAC 1 cut(s) 443
RsaNI GTAC 1 cut(s) 442
SaqAI TTAA 2 cut(s) 194, 239
SatI GCNGC 1 cut(s) 51
Sau3AI GATC 1 cut(s) 85
SfaNI GCATC 2 cut(s) 13, 383
Sfr274I CTCGAG 1 cut(s) 54
SfuI TTCGAA 2 cut(s) 322, 337
SlaI CTCGAG 1 cut(s) 54
SmlI CTYRAG 2 cut(s) 54, 238
SmoI CTYRAG 2 cut(s) 54, 238
SspMI CTAG 4 cut(s) 152, 183, 384, 574
TaqI TCGA 3 cut(s) 55, 322, 337
TatI WGTACW 1 cut(s) 441
TfiI GAWTC 1 cut(s) 13
Tru1I TTAA 2 cut(s) 194, 239
Tru9I TTAA 2 cut(s) 194, 239
TseI GCWGC 1 cut(s) 50
TspDTI ATGAA 4 cut(s) 162, 267, 293, 365
Vha464I CTTAAG 1 cut(s) 238
XceI RCATGY 1 cut(s) 497
XhoI CTCGAG 1 cut(s) 54
XmnI GAANNNNTTC 1 cut(s) 333
XspI CTAG 4 cut(s) 152, 183, 384, 574
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.