Rmu_sc0026896.1_g000002

transposition, RNA-mediated

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0026896.1
OG0000562
Physical Location & Seq
Forward (+)
6868 .. 7636
769 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0026896.1_g000002.1.cds

Sequence Viewer

Length: 648 bp
atgtatggaaatcagaataatgttgctcaagtttttcaactcaaacgagatattgctgatcttcaacaagaaggtaagccttttgttcaacacctcggtagtcttacaagcatgtggaatgagctggatgtttatagacctcataccaccgaggctagggttttgttaaagagagatgaggaggacaagatttttcaactcctcgcaagcttaagttcagattatgaagacttgaggagtcacattcttatgaatgctaagctaccatctttcaacaatgtgtgtgctactattcaaagggaagaggttcgaaaaaaggtgatgaatatggaggccaagacaagtgtatctgaaactagagcttatgtctttaatcacaggcaagctgaagctaaagtgtacaaaggcaagagaccagacttgaagtgcagctactataattcttctactccttctgaaggtatgctgaagttcacctccaatcctaccactttcatcaacgaattttctacctatctcagcaagaagcagatgcaaagtggaggtgaagaaacagccatgcctggaattgaaggccacactgatcttcttggaaaatttgttggtttccttgcaaaaactgattatgttccacatgaagaagcttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Retrotran_gag_2 Retrotran_gag_3 Retrotrans_gag rve

Protein Analysis

215

Amino Acids

24.56

Weight (kDa)

6.6

Isoelectric Point (pI)

41.93

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000562)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g17331 FvH4_3g36541
malus_domestica MD07G1078600.v1.1 MD10G1237700.v1.1 MD10G1333400.v1.1 MD11G1102200.v1.1 MD13G1138400.v1.1 MD14G1033400.v1.1 MD15G1053300.v1.1
prunus_persica Prupe.1G465400_v2.0.a1 Prupe.3G136000_v2.0.a1 Prupe.7G119900_v2.0.a1
pyrus_communis pycom01g04630 pycom03g13050 pycom04g21190 pycom05g04910 pycom05g05510 pycom08g15850 pycom09g15040 pycom1094g00010 pycom11g02000 pycom12g06150 pycom13g24110 pycom13g24910 pycom14g00050 pycom15g21970 pycom15g35170 pycom15g35180 pycom16g14620 pycom16g14630 pycom808g00110
rosa_chinensis RchiOBHm_Chr1g0322851 RchiOBHm_Chr1g0365941 RchiOBHm_Chr3g0453341 RchiOBHm_Chr4g0388371 RchiOBHm_Chr4g0394021 RchiOBHm_Chr5g0013181 RchiOBHm_Chr6g0261721 RchiOBHm_Chr6g0261731 RchiOBHm_Chr7g0188861 RchiOBHm_Chr7g0192331 RchiOBHm_Chr7g0231721
rosa_multiflora Rmu_sc0002521.1_g000006 Rmu_sc0003255.1_g000026 Rmu_sc0004191.1_g000036 Rmu_sc0004414.1_g000014 Rmu_sc0005670.1_g000006 Rmu_sc0006081.1_g000001 Rmu_sc0007215.1_g000004 Rmu_sc0010088.1_g000010 Rmu_sc0020285.1_g000003 Rmu_sc0026896.1_g000002 Rmu_ssc0000019.1_g000029
rosa_roxburghii Rroxscaffold_3G00224890 Rroxscaffold_6G00400640 Rroxscaffold_7G00176590 Rroxscaffold_7G00189230
rosa_samantha Rh4BG046700
rosa_wichuraiana Rw1G012690 Rw1G031370 Rw2G042180 Rw2G043670 Rw2G046240 Rw2G049890 Rw2G050760 Rw2G051280 Rw2G053590 Rw3G007590 Rw3G026850 Rw4G001540 Rw4G009760 Rw4G019270 Rw5G000720 Rw5G005620 Rw5G041560 Rw6G007370 Rw6G009830 Rw6G015360 Rw6G031160 Rw7G004930 Rw7G011010 Rw7G024230 Rw7G028240

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 503, 596
AcuI CTGAAG 3 cut(s) 408, 477, 488
AfaI GTAC 1 cut(s) 401
AfiI CCNNNNNNNGG 2 cut(s) 156, 458
AflII CTTAAG 1 cut(s) 211
AgsI TTSAA 8 cut(s) 38, 65, 89, 197, 274, 296, 424, 572
AjnI CCWGG 1 cut(s) 562
AluBI AGCT 8 cut(s) 124, 210, 262, 362, 386, 392, 432, 644
AluI AGCT 8 cut(s) 124, 210, 262, 362, 386, 392, 432, 644
Alw26I GTCTC 1 cut(s) 406
AoxI GGCC 2 cut(s) 333, 574
ApeKI GCWGC 1 cut(s) 429
ApoI RAATTY 2 cut(s) 503, 596
Asp700I GAANNNNTTC 1 cut(s) 306
AsuHPI GGTGA 3 cut(s) 331, 466, 557
AsuII TTCGAA 1 cut(s) 310
BaeI ACNNNNGTAYC 2 cut(s) 330, 363
BarI GAAGNNNNNNTAC 2 cut(s) 416, 448
BbsI GAAGAC 1 cut(s) 234
BbvI GCAGC 1 cut(s) 441
BccI CCATC 1 cut(s) 274
BciT130I CCWGG 1 cut(s) 564
BcoDI GTCTC 1 cut(s) 406
BfaI CTAG 2 cut(s) 156, 357
BfrI CTTAAG 1 cut(s) 211
BisI GCNGC 1 cut(s) 430
BlpI GCTNAGC 1 cut(s) 258
BlsI GCNGC 1 cut(s) 431
Bme1390I CCNGG 1 cut(s) 564
BmrFI CCNGG 1 cut(s) 564
BmsI GCATC 1 cut(s) 522
BpiI GAAGAC 1 cut(s) 234
Bpu1102I GCTNAGC 1 cut(s) 258
Bpu14I TTCGAA 1 cut(s) 310
BpuEI CTTGAG 2 cut(s) 12, 253
BsaI GGTCTC 1 cut(s) 406
BsaJI CCNNGG 2 cut(s) 94, 150
Bsc4I CCNNNNNNNGG 2 cut(s) 156, 458
BseBI CCWGG 1 cut(s) 564
BseDI CCNNGG 2 cut(s) 94, 150
BseGI GGATG 1 cut(s) 133
BseLI CCNNNNNNNGG 2 cut(s) 156, 458
BseMII CTCAG 1 cut(s) 532
BseRI GAGGAG 3 cut(s) 191, 194, 250
BseXI GCAGC 1 cut(s) 441
BsgI GTGCAG 1 cut(s) 448
BshFI GGCC 2 cut(s) 335, 576
BslI CCNNNNNNNGG 2 cut(s) 156, 458
BsmAI GTCTC 1 cut(s) 406
BsmI GAATGC 1 cut(s) 259
BsnI GGCC 2 cut(s) 335, 576
Bso31I GGTCTC 1 cut(s) 406
Bsp119I TTCGAA 1 cut(s) 310
Bsp1407I TGTACA 1 cut(s) 399
Bsp143I GATC 2 cut(s) 58, 583
Bsp1720I GCTNAGC 1 cut(s) 258
BspANI GGCC 2 cut(s) 335, 576
BspCNI CTCAG 1 cut(s) 531
BspT104I TTCGAA 1 cut(s) 310
BspTI CTTAAG 1 cut(s) 211
BspTNI GGTCTC 1 cut(s) 406
BsrGI TGTACA 1 cut(s) 399
BssECI CCNNGG 2 cut(s) 94, 150
BssMI GATC 2 cut(s) 58, 583
Bst2UI CCWGG 1 cut(s) 564
Bst6I CTCTTC 1 cut(s) 297
BstAFI CTTAAG 1 cut(s) 211
BstAUI TGTACA 1 cut(s) 399
BstBI TTCGAA 1 cut(s) 310
BstC8I GCNNGC 2 cut(s) 208, 384
BstDEI CTNAG 2 cut(s) 258, 518
BstENI CCTNNNNNAGG 1 cut(s) 456
BstF5I GGATG 1 cut(s) 133
BstKTI GATC 2 cut(s) 61, 586
BstMAI GTCTC 1 cut(s) 406
BstMBI GATC 2 cut(s) 58, 583
BstNI CCWGG 1 cut(s) 564
BstNSI RCATGY 1 cut(s) 115
BstSCI CCNGG 1 cut(s) 562
BstV1I GCAGC 1 cut(s) 441
BstV2I GAAGAC 1 cut(s) 234
BsuRI GGCC 2 cut(s) 335, 576
BtsCI GGATG 1 cut(s) 133
BtsIMutI CAGTG 1 cut(s) 579
Cac8I GCNNGC 2 cut(s) 208, 384
Csp6I GTAC 1 cut(s) 400
CviAII CATG 3 cut(s) 112, 559, 635
CviQI GTAC 1 cut(s) 400
DdeI CTNAG 2 cut(s) 258, 518
DpnI GATC 2 cut(s) 60, 585
DpnII GATC 2 cut(s) 58, 583
Eam1104I CTCTTC 1 cut(s) 297
EarI CTCTTC 1 cut(s) 297
Eco31I GGTCTC 1 cut(s) 406
Eco57I CTGAAG 3 cut(s) 408, 477, 488
EcoNI CCTNNNNNAGG 1 cut(s) 456
EcoRII CCWGG 1 cut(s) 562
FaeI CATG 3 cut(s) 115, 562, 638
FatI CATG 3 cut(s) 111, 558, 634
Fnu4HI GCNGC 1 cut(s) 430
FokI GGATG 1 cut(s) 140
Fsp4HI GCNGC 1 cut(s) 430
FspBI CTAG 2 cut(s) 156, 357
GluI GCNGC 1 cut(s) 430
HaeIII GGCC 2 cut(s) 335, 576
Hin1II CATG 3 cut(s) 115, 562, 638
HindIII AAGCTT 2 cut(s) 208, 642
HinfI GANTC 1 cut(s) 238
HphI GGTGA 3 cut(s) 331, 466, 557
Hpy166II GTNNAC 2 cut(s) 400, 474
Hpy188I TCNGA 4 cut(s) 15, 220, 352, 457
Hpy8I GTNNAC 2 cut(s) 400, 474
HpyAV CCTTC 4 cut(s) 65, 452, 462, 566
HpyCH4V TGCA 3 cut(s) 429, 535, 614
HpyF3I CTNAG 2 cut(s) 258, 518
Hsp92II CATG 3 cut(s) 115, 562, 638
Kzo9I GATC 2 cut(s) 58, 583
LpnPI CCDG 5 cut(s) 110, 364, 429, 549, 576
Lsp1109I GCAGC 1 cut(s) 441
LweI GCATC 1 cut(s) 522
MaeI CTAG 2 cut(s) 156, 357
MaeIII GTNAC 1 cut(s) 239
MalI GATC 2 cut(s) 60, 585
MboI GATC 2 cut(s) 58, 583
MboII GAAGA 6 cut(s) 53, 239, 314, 435, 560, 578
MluCI AATT 4 cut(s) 439, 503, 567, 596
MlyI GAGTC 1 cut(s) 247
MroXI GAANNNNTTC 1 cut(s) 306
MseI TTAA 4 cut(s) 167, 212, 372, 646
MslI CAYNNNNRTG 1 cut(s) 248
MspCI CTTAAG 1 cut(s) 211
MspR9I CCNGG 1 cut(s) 564
Mva1269I GAATGC 1 cut(s) 259
MvaI CCWGG 1 cut(s) 564
NdeII GATC 2 cut(s) 58, 583
NlaIII CATG 3 cut(s) 115, 562, 638
NmuCI GTSAC 1 cut(s) 239
NspI RCATGY 1 cut(s) 115
NspV TTCGAA 1 cut(s) 310
PctI GAATGC 1 cut(s) 259
PdmI GAANNNNTTC 1 cut(s) 306
PkrI GCNGC 1 cut(s) 431
PleI GAGTC 1 cut(s) 246
PpsI GAGTC 1 cut(s) 246
Psp6I CCWGG 1 cut(s) 562
PspGI CCWGG 1 cut(s) 562
RsaI GTAC 1 cut(s) 401
RsaNI GTAC 1 cut(s) 400
RseI CAYNNNNRTG 1 cut(s) 248
SaqAI TTAA 4 cut(s) 167, 212, 372, 646
SatI GCNGC 1 cut(s) 430
Sau3AI GATC 2 cut(s) 58, 583
SchI GAGTC 1 cut(s) 247
ScrFI CCNGG 1 cut(s) 564
SfaNI GCATC 1 cut(s) 522
SfuI TTCGAA 1 cut(s) 310
SmiMI CAYNNNNRTG 1 cut(s) 248
SmlI CTYRAG 3 cut(s) 27, 211, 232
SmoI CTYRAG 3 cut(s) 27, 211, 232
Sse9I AATT 4 cut(s) 439, 503, 567, 596
SspMI CTAG 2 cut(s) 156, 357
StyD4I CCNGG 1 cut(s) 562
TaqI TCGA 1 cut(s) 310
TasI AATT 4 cut(s) 439, 503, 567, 596
TatI WGTACW 1 cut(s) 399
Tru1I TTAA 4 cut(s) 167, 212, 372, 646
Tru9I TTAA 4 cut(s) 167, 212, 372, 646
TscAI CASTG 1 cut(s) 586
TseFI GTSAC 1 cut(s) 239
TseI GCWGC 1 cut(s) 429
Tsp45I GTSAC 1 cut(s) 239
TspDTI ATGAA 4 cut(s) 240, 266, 338, 484
TspRI CASTG 1 cut(s) 586
Vha464I CTTAAG 1 cut(s) 211
XagI CCTNNNNNAGG 1 cut(s) 456
XapI RAATTY 2 cut(s) 503, 596
XceI RCATGY 1 cut(s) 115
XmnI GAANNNNTTC 1 cut(s) 306
XspI CTAG 2 cut(s) 156, 357
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.