pycom03g13050

transposition, RNA-mediated

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr3
OG0000562
Physical Location & Seq
Forward (+)
13951087 .. 13952102
1016 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom03g13050.1

Sequence Viewer

Length: 414 bp
ATGGCTGAGGAAAATCCTCCCAGTCCTGATACTGTAAGCTGTATTGTTTCACCCACTTTAAATTTTACCAAAGTAGAAGTTAATCCAAATCAAAGATTCAGTTCAGTTTTGTTGAATGAGTTCAACTATCTTCAATGGTCTCGAGCAGTTTCACTTGCTCTCGGTGGAAGATCGAAGCTTGGTTACGTGAATGGAACCATTCAGGCACCTGAAATCTCATCACCTTTATATGAGACATGGCTATGCAAGGATCACCTTGTCATGTCATGGATTCTCAACTCCAAGTCTTTTTTCCATCTTTGGAAAAAATTTTGTGAGATTTCTGTGCATGTGGTTCAAGTGCTGTGCAATAATGAAGTGTCAGAGGAGGTGTTTGTCTTTGATTACGTGTGGATGGAGGAAAACATGTGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_2 Retrotran_gag_2 Retrotran_gag_3 Retrotrans_gag gag_pre-integrs rve

Protein Analysis

138

Amino Acids

15.84

Weight (kDa)

4.95

Isoelectric Point (pI)

50.14

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Retrotran_gag_3 PF14244 32 - 71 2.1e-14 gag-polypeptide of LTR copia-type
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000562)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g17331 FvH4_3g36541
malus_domestica MD07G1078600.v1.1 MD10G1237700.v1.1 MD10G1333400.v1.1 MD11G1102200.v1.1 MD13G1138400.v1.1 MD14G1033400.v1.1 MD15G1053300.v1.1
prunus_persica Prupe.1G465400_v2.0.a1 Prupe.3G136000_v2.0.a1 Prupe.7G119900_v2.0.a1
pyrus_communis pycom01g04630 pycom03g13050 pycom04g21190 pycom05g04910 pycom05g05510 pycom08g15850 pycom09g15040 pycom1094g00010 pycom11g02000 pycom12g06150 pycom13g24110 pycom13g24910 pycom14g00050 pycom15g21970 pycom15g35170 pycom15g35180 pycom16g14620 pycom16g14630 pycom808g00110
rosa_chinensis RchiOBHm_Chr1g0322851 RchiOBHm_Chr1g0365941 RchiOBHm_Chr3g0453341 RchiOBHm_Chr4g0388371 RchiOBHm_Chr4g0394021 RchiOBHm_Chr5g0013181 RchiOBHm_Chr6g0261721 RchiOBHm_Chr6g0261731 RchiOBHm_Chr7g0188861 RchiOBHm_Chr7g0192331 RchiOBHm_Chr7g0231721
rosa_multiflora Rmu_sc0002521.1_g000006 Rmu_sc0003255.1_g000026 Rmu_sc0004191.1_g000036 Rmu_sc0004414.1_g000014 Rmu_sc0005670.1_g000006 Rmu_sc0006081.1_g000001 Rmu_sc0007215.1_g000004 Rmu_sc0010088.1_g000010 Rmu_sc0020285.1_g000003 Rmu_sc0026896.1_g000002 Rmu_ssc0000019.1_g000029
rosa_roxburghii Rroxscaffold_3G00224890 Rroxscaffold_6G00400640 Rroxscaffold_7G00176590 Rroxscaffold_7G00189230
rosa_samantha Rh4BG046700
rosa_wichuraiana Rw1G012690 Rw1G031370 Rw2G042180 Rw2G043670 Rw2G046240 Rw2G049890 Rw2G050760 Rw2G051280 Rw2G053590 Rw3G007590 Rw3G026850 Rw4G001540 Rw4G009760 Rw4G019270 Rw5G000720 Rw5G005620 Rw5G041560 Rw6G007370 Rw6G009830 Rw6G015360 Rw6G031160 Rw7G004930 Rw7G011010 Rw7G024230 Rw7G028240

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 205
AclWI GGATC 1 cut(s) 258
AcsI RAATTY 2 cut(s) 61, 308
AflIII ACRYGT 2 cut(s) 387, 405
AgsI TTSAA 4 cut(s) 115, 124, 134, 338
AjuI GAANNNNNNNTTGG 2 cut(s) 275, 307
AluBI AGCT 2 cut(s) 39, 178
AluI AGCT 2 cut(s) 39, 178
Alw26I GTCTC 2 cut(s) 144, 227
AlwI GGATC 1 cut(s) 258
Ama87I CYCGRG 1 cut(s) 141
ApoI RAATTY 2 cut(s) 61, 308
Asp700I GAANNNNTTC 1 cut(s) 119
AsuHPI GGTGA 3 cut(s) 42, 213, 245
AvaI CYCGRG 1 cut(s) 141
BanI GGYRCC 1 cut(s) 205
BarI GAAGNNNNNNTAC 2 cut(s) 167, 199
BbvCI CCTCAGC 1 cut(s) 6
BccI CCATC 2 cut(s) 303, 388
BcoDI GTCTC 2 cut(s) 144, 227
BmeT110I CYCGRG 1 cut(s) 141
BmiI GGNNCC 2 cut(s) 196, 207
BmrI ACTGGG 1 cut(s) 15
BmuI ACTGGG 1 cut(s) 15
Bpu10I CCTNAGC 1 cut(s) 6
BsaAI YACGTR 2 cut(s) 187, 388
BsaI GGTCTC 1 cut(s) 144
Bse1I ACTGG 1 cut(s) 21
BseGI GGATG 1 cut(s) 399
BseNI ACTGG 1 cut(s) 21
BseRI GAGGAG 1 cut(s) 380
BshNI GGYRCC 1 cut(s) 205
BsiHKCI CYCGRG 1 cut(s) 141
BsmAI GTCTC 2 cut(s) 144, 227
Bso31I GGTCTC 1 cut(s) 144
BsoBI CYCGRG 1 cut(s) 141
Bsp143I GATC 2 cut(s) 170, 250
BspLI GGNNCC 2 cut(s) 196, 207
BspPI GGATC 1 cut(s) 258
BspT107I GGYRCC 1 cut(s) 205
BspTNI GGTCTC 1 cut(s) 144
BsrI ACTGG 1 cut(s) 21
BssMI GATC 2 cut(s) 170, 250
Bst4CI ACNGT 1 cut(s) 34
BstBAI YACGTR 2 cut(s) 187, 388
BstDEI CTNAG 1 cut(s) 6
BstF5I GGATG 1 cut(s) 399
BstKTI GATC 2 cut(s) 173, 253
BstMAI GTCTC 2 cut(s) 144, 227
BstMBI GATC 2 cut(s) 170, 250
BstNSI RCATGY 2 cut(s) 332, 409
BtsCI GGATG 1 cut(s) 399
CviAII CATG 5 cut(s) 237, 262, 267, 329, 406
CviJI RGCY 4 cut(s) 5, 39, 178, 241
CviKI_1 RGCY 4 cut(s) 5, 39, 178, 241
DdeI CTNAG 1 cut(s) 6
DpnI GATC 2 cut(s) 172, 252
DpnII GATC 2 cut(s) 170, 250
DraI TTTAAA 1 cut(s) 60
Eco31I GGTCTC 1 cut(s) 144
Eco88I CYCGRG 1 cut(s) 141
FaeI CATG 5 cut(s) 240, 265, 270, 332, 409
FaiI YATR 8 cut(s) 229, 231, 238, 244, 263, 268, 330, 407
FatI CATG 5 cut(s) 236, 261, 266, 328, 405
FokI GGATG 1 cut(s) 406
Hin1II CATG 5 cut(s) 240, 265, 270, 332, 409
HindIII AAGCTT 1 cut(s) 176
HinfI GANTC 2 cut(s) 96, 271
HphI GGTGA 3 cut(s) 42, 213, 245
Hpy188I TCNGA 1 cut(s) 364
Hpy188III TCNNGA 2 cut(s) 26, 141
HpyCH4III ACNGT 1 cut(s) 34
HpyCH4IV ACGT 2 cut(s) 186, 387
HpyCH4V TGCA 3 cut(s) 246, 328, 348
HpyF3I CTNAG 1 cut(s) 6
HpySE526I ACGT 2 cut(s) 186, 387
Hsp92II CATG 5 cut(s) 240, 265, 270, 332, 409
Kzo9I GATC 2 cut(s) 170, 250
LpnPI CCDG 4 cut(s) 34, 39, 188, 222
MaeII ACGT 2 cut(s) 186, 387
MaeIII GTNAC 1 cut(s) 182
MalI GATC 2 cut(s) 172, 252
MboI GATC 2 cut(s) 170, 250
MboII GAAGA 2 cut(s) 122, 180
MluCI AATT 2 cut(s) 61, 308
MnlI CCTC 4 cut(s) 27, 358, 361, 391
MroXI GAANNNNTTC 1 cut(s) 119
MseI TTAA 2 cut(s) 59, 81
MslI CAYNNNNRTG 1 cut(s) 241
NdeII GATC 2 cut(s) 170, 250
NlaIII CATG 5 cut(s) 240, 265, 270, 332, 409
NlaIV GGNNCC 2 cut(s) 196, 207
NspI RCATGY 2 cut(s) 332, 409
PaeR7I CTCGAG 1 cut(s) 141
PciI ACATGT 1 cut(s) 405
PdmI GAANNNNTTC 1 cut(s) 119
PfeI GAWTC 2 cut(s) 96, 271
Ppu21I YACGTR 2 cut(s) 187, 388
PscI ACATGT 1 cut(s) 405
PspN4I GGNNCC 2 cut(s) 196, 207
RseI CAYNNNNRTG 1 cut(s) 241
SaqAI TTAA 2 cut(s) 59, 81
Sau3AI GATC 2 cut(s) 170, 250
SetI ASST 8 cut(s) 41, 180, 189, 211, 226, 258, 372, 390
Sfr274I CTCGAG 1 cut(s) 141
SlaI CTCGAG 1 cut(s) 141
SmiMI CAYNNNNRTG 1 cut(s) 241
SmlI CTYRAG 1 cut(s) 141
SmoI CTYRAG 1 cut(s) 141
Sse9I AATT 2 cut(s) 61, 308
TaaI ACNGT 1 cut(s) 34
TaiI ACGT 2 cut(s) 189, 390
TaqI TCGA 2 cut(s) 142, 173
TasI AATT 2 cut(s) 61, 308
TfiI GAWTC 2 cut(s) 96, 271
Tru1I TTAA 2 cut(s) 59, 81
Tru9I TTAA 2 cut(s) 59, 81
TspDTI ATGAA 1 cut(s) 369
XapI RAATTY 2 cut(s) 61, 308
XceI RCATGY 2 cut(s) 332, 409
XhoI CTCGAG 1 cut(s) 141
XmnI GAANNNNTTC 1 cut(s) 119
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.