pycom16g14620

transposition, RNA-mediated

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr16
OG0000562
Physical Location & Seq
Forward (+)
10713143 .. 10713436
294 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom16g14620.1

Sequence Viewer

Length: 294 bp
ATGTCTGAAGACAATCCGCTGATATCCGAAGCTGAAAGCTCACAGGAGCCTTCCTCCATGAACGTGCATGAGGTGGACGTCAACCCAAATCAAAGATTAAGCTCAGTCGTGTTGAATGAGTTTAATTACTTTCCTTGGTCGAGAGATGTGTCTTTGGCGCTAGGTGGAAAGTCCAAGCTGGGGTTCATAAATGGAAGCTTCAAAATACCTGATGTTTCCTCACCAAACTATGAATCCTGGCTTAGCAAGGATCGAGCTTCTTATGTCATGGCTTTTGAATTCCATGGATCGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_2 Retrotran_gag_2 Retrotran_gag_3 Retrotrans_gag gag_pre-integrs rve

Protein Analysis

98

Amino Acids

10.83

Weight (kDa)

4.66

Isoelectric Point (pI)

39.92

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Retrotran_gag_3 PF14244 31 - 70 1.2e-13 gag-polypeptide of LTR copia-type
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000562)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g17331 FvH4_3g36541
malus_domestica MD07G1078600.v1.1 MD10G1237700.v1.1 MD10G1333400.v1.1 MD11G1102200.v1.1 MD13G1138400.v1.1 MD14G1033400.v1.1 MD15G1053300.v1.1
prunus_persica Prupe.1G465400_v2.0.a1 Prupe.3G136000_v2.0.a1 Prupe.7G119900_v2.0.a1
pyrus_communis pycom01g04630 pycom03g13050 pycom04g21190 pycom05g04910 pycom05g05510 pycom08g15850 pycom09g15040 pycom1094g00010 pycom11g02000 pycom12g06150 pycom13g24110 pycom13g24910 pycom14g00050 pycom15g21970 pycom15g35170 pycom15g35180 pycom16g14620 pycom16g14630 pycom808g00110
rosa_chinensis RchiOBHm_Chr1g0322851 RchiOBHm_Chr1g0365941 RchiOBHm_Chr3g0453341 RchiOBHm_Chr4g0388371 RchiOBHm_Chr4g0394021 RchiOBHm_Chr5g0013181 RchiOBHm_Chr6g0261721 RchiOBHm_Chr6g0261731 RchiOBHm_Chr7g0188861 RchiOBHm_Chr7g0192331 RchiOBHm_Chr7g0231721
rosa_multiflora Rmu_sc0002521.1_g000006 Rmu_sc0003255.1_g000026 Rmu_sc0004191.1_g000036 Rmu_sc0004414.1_g000014 Rmu_sc0005670.1_g000006 Rmu_sc0006081.1_g000001 Rmu_sc0007215.1_g000004 Rmu_sc0010088.1_g000010 Rmu_sc0020285.1_g000003 Rmu_sc0026896.1_g000002 Rmu_ssc0000019.1_g000029
rosa_roxburghii Rroxscaffold_3G00224890 Rroxscaffold_6G00400640 Rroxscaffold_7G00176590 Rroxscaffold_7G00189230
rosa_samantha Rh4BG046700
rosa_wichuraiana Rw1G012690 Rw1G031370 Rw2G042180 Rw2G043670 Rw2G046240 Rw2G049890 Rw2G050760 Rw2G051280 Rw2G053590 Rw3G007590 Rw3G026850 Rw4G001540 Rw4G009760 Rw4G019270 Rw5G000720 Rw5G005620 Rw5G041560 Rw6G007370 Rw6G009830 Rw6G015360 Rw6G031160 Rw7G004930 Rw7G011010 Rw7G024230 Rw7G028240

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 81
AciI CCGC 1 cut(s) 17
AclWI GGATC 1 cut(s) 258
AcsI RAATTY 1 cut(s) 278
AcuI CTGAAG 1 cut(s) 27
AcyI GRCGYC 1 cut(s) 78
AfiI CCNNNNNNNGG 1 cut(s) 180
AgsI TTSAA 3 cut(s) 115, 202, 278
AjnI CCWGG 1 cut(s) 236
AjuI GAANNNNNNNTTGG 2 cut(s) 167, 199
AluBI AGCT 6 cut(s) 32, 39, 102, 178, 198, 257
AluI AGCT 6 cut(s) 32, 39, 102, 178, 198, 257
AlwI GGATC 1 cut(s) 258
ApoI RAATTY 1 cut(s) 278
AspLEI GCGC 1 cut(s) 160
AsuHPI GGTGA 1 cut(s) 213
BbsI GAAGAC 1 cut(s) 15
BciT130I CCWGG 1 cut(s) 238
BfaI CTAG 1 cut(s) 161
BfoI RGCGCY 1 cut(s) 161
BlpI GCTNAGC 1 cut(s) 242
Bme1390I CCNGG 1 cut(s) 238
BmiI GGNNCC 1 cut(s) 48
BmrFI CCNGG 1 cut(s) 238
BpiI GAAGAC 1 cut(s) 15
BplI GAGNNNNNCTC 2 cut(s) 38, 70
Bpu1102I GCTNAGC 1 cut(s) 242
BsaHI GRCGYC 1 cut(s) 78
BsaJI CCNNGG 2 cut(s) 134, 283
Bsc4I CCNNNNNNNGG 1 cut(s) 180
BseBI CCWGG 1 cut(s) 238
BseDI CCNNGG 2 cut(s) 134, 283
BseLI CCNNNNNNNGG 1 cut(s) 180
BseMII CTCAG 1 cut(s) 117
BseYI CCCAGC 1 cut(s) 178
BslI CCNNNNNNNGG 1 cut(s) 180
Bsp143I GATC 2 cut(s) 250, 287
Bsp1720I GCTNAGC 1 cut(s) 242
Bsp19I CCATGG 1 cut(s) 283
BspACI CCGC 1 cut(s) 17
BspCNI CTCAG 1 cut(s) 116
BspLI GGNNCC 1 cut(s) 48
BspPI GGATC 1 cut(s) 258
BssECI CCNNGG 2 cut(s) 134, 283
BssMI GATC 2 cut(s) 250, 287
BssNI GRCGYC 1 cut(s) 78
BssT1I CCWWGG 2 cut(s) 134, 283
Bst2UI CCWGG 1 cut(s) 238
BstACI GRCGYC 1 cut(s) 78
BstDEI CTNAG 2 cut(s) 103, 242
BstDSI CCRYGG 1 cut(s) 283
BstH2I RGCGCY 1 cut(s) 161
BstHHI GCGC 1 cut(s) 160
BstKTI GATC 2 cut(s) 253, 290
BstMBI GATC 2 cut(s) 250, 287
BstNI CCWGG 1 cut(s) 238
BstSCI CCNGG 1 cut(s) 236
BstV2I GAAGAC 1 cut(s) 15
BtgI CCRYGG 1 cut(s) 283
CfoI GCGC 1 cut(s) 160
CviAII CATG 4 cut(s) 58, 68, 268, 284
CviJI RGCY 9 cut(s) 32, 39, 49, 102, 178, 198, 241, 257, 272
CviKI_1 RGCY 9 cut(s) 32, 39, 49, 102, 178, 198, 241, 257, 272
DdeI CTNAG 2 cut(s) 103, 242
DpnI GATC 2 cut(s) 252, 289
DpnII GATC 2 cut(s) 250, 287
Eco130I CCWWGG 2 cut(s) 134, 283
Eco32I GATATC 1 cut(s) 24
Eco57I CTGAAG 1 cut(s) 27
EcoRI GAATTC 1 cut(s) 278
EcoRII CCWGG 1 cut(s) 236
EcoRV GATATC 1 cut(s) 24
EcoT14I CCWWGG 2 cut(s) 134, 283
ErhI CCWWGG 2 cut(s) 134, 283
FaeI CATG 4 cut(s) 61, 71, 271, 287
FaiI YATR 7 cut(s) 59, 69, 188, 231, 264, 269, 285
FatI CATG 4 cut(s) 57, 67, 267, 283
FspBI CTAG 1 cut(s) 161
GlaI GCGC 1 cut(s) 159
GsaI CCCAGC 1 cut(s) 182
HaeII RGCGCY 1 cut(s) 161
HhaI GCGC 1 cut(s) 160
Hin1I GRCGYC 1 cut(s) 78
Hin1II CATG 4 cut(s) 61, 71, 271, 287
Hin6I GCGC 1 cut(s) 158
HinP1I GCGC 1 cut(s) 158
HincII GTYRAC 1 cut(s) 82
HindII GTYRAC 1 cut(s) 82
HindIII AAGCTT 1 cut(s) 196
HinfI GANTC 1 cut(s) 233
HphI GGTGA 1 cut(s) 213
Hpy166II GTNNAC 2 cut(s) 76, 82
Hpy188I TCNGA 2 cut(s) 7, 28
Hpy188III TCNNGA 1 cut(s) 141
Hpy8I GTNNAC 2 cut(s) 76, 82
HpyAV CCTTC 1 cut(s) 60
HpyCH4IV ACGT 2 cut(s) 63, 78
HpyCH4V TGCA 1 cut(s) 67
HpyF3I CTNAG 2 cut(s) 103, 242
HpySE526I ACGT 2 cut(s) 63, 78
Hsp92I GRCGYC 1 cut(s) 78
Hsp92II CATG 4 cut(s) 61, 71, 271, 287
HspAI GCGC 1 cut(s) 158
Kzo9I GATC 2 cut(s) 250, 287
LmnI GCTCC 1 cut(s) 46
LpnPI CCDG 5 cut(s) 29, 164, 222, 223, 250
MaeI CTAG 1 cut(s) 161
MaeII ACGT 2 cut(s) 63, 78
MalI GATC 2 cut(s) 252, 289
MboI GATC 2 cut(s) 250, 287
MboII GAAGA 1 cut(s) 20
MluCI AATT 2 cut(s) 124, 278
MnlI CCTC 3 cut(s) 64, 64, 229
MseI TTAA 2 cut(s) 98, 123
MslI CAYNNNNRTG 1 cut(s) 62
MspA1I CMGCKG 1 cut(s) 19
MspR9I CCNGG 1 cut(s) 238
MvaI CCWGG 1 cut(s) 238
NcoI CCATGG 1 cut(s) 283
NdeII GATC 2 cut(s) 250, 287
NlaIII CATG 4 cut(s) 61, 71, 271, 287
NlaIV GGNNCC 1 cut(s) 48
PfeI GAWTC 1 cut(s) 233
Psp6I CCWGG 1 cut(s) 236
PspFI CCCAGC 1 cut(s) 178
PspGI CCWGG 1 cut(s) 236
PspN4I GGNNCC 1 cut(s) 48
RseI CAYNNNNRTG 1 cut(s) 62
SaqAI TTAA 2 cut(s) 98, 123
Sau3AI GATC 2 cut(s) 250, 287
ScrFI CCNGG 1 cut(s) 238
SmiMI CAYNNNNRTG 1 cut(s) 62
Sse9I AATT 2 cut(s) 124, 278
SsiI CCGC 1 cut(s) 17
SspMI CTAG 1 cut(s) 161
StyD4I CCNGG 1 cut(s) 236
StyI CCWWGG 2 cut(s) 134, 283
TaiI ACGT 2 cut(s) 66, 81
TaqI TCGA 2 cut(s) 140, 253
TasI AATT 2 cut(s) 124, 278
TfiI GAWTC 1 cut(s) 233
Tru1I TTAA 2 cut(s) 98, 123
Tru9I TTAA 2 cut(s) 98, 123
TspDTI ATGAA 3 cut(s) 74, 175, 246
XapI RAATTY 1 cut(s) 278
XspI CTAG 1 cut(s) 161
ZraI GACGTC 1 cut(s) 79
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.