Rmu_sc0020285.1_g000003

transposition, RNA-mediated

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0020285.1
Physical Location & Seq
Reverse (-)
3271 .. 4210
940 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0020285.1_g000003.1.cds

Sequence Viewer

Length: 561 bp
atggaaactaagactagtgcatctgaaactagagcttatgttgctaatcacaacccagcagaagctaaggtgtacaaaggcaagagacctgacttgaaatgcagctactgtgagggtattggacatgtcagggatagatgttgggttctctatcttgaacagaagccaaagtttctgaaggaaggaaaagtttctcaaaagagttggaatccaccaaaagcaaacctggcagcaactagttctgagggtatgctgaatttcacctccaatcctactactttaatcaatgaatttgctgcctatctcagcaagaagcatatgcatggtggaggtgaagaaactaccatgcctgggattgaaggccacactgcactccgtggaaaatttgatctcatcaccaagaagacgattggtgaaggtttctttttgaatggtctttattatctgtccaagaattcttttgattccaaggttttccaagtcagttcaagatcagcacaagatcatcatctatggcataaacgcttggctccgtggtgtgccctctacacttcattgtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

186

Amino Acids

20.93

Weight (kDa)

9.38

Isoelectric Point (pI)

37.79

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000562)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g17331 FvH4_3g36541
malus_domestica MD07G1078600.v1.1 MD10G1237700.v1.1 MD10G1333400.v1.1 MD11G1102200.v1.1 MD13G1138400.v1.1 MD14G1033400.v1.1 MD15G1053300.v1.1
prunus_persica Prupe.1G465400_v2.0.a1 Prupe.3G136000_v2.0.a1 Prupe.7G119900_v2.0.a1
pyrus_communis pycom01g04630 pycom03g13050 pycom04g21190 pycom05g04910 pycom05g05510 pycom08g15850 pycom09g15040 pycom1094g00010 pycom11g02000 pycom12g06150 pycom13g24110 pycom13g24910 pycom14g00050 pycom15g21970 pycom15g35170 pycom15g35180 pycom16g14620 pycom16g14630 pycom808g00110
rosa_chinensis RchiOBHm_Chr1g0322851 RchiOBHm_Chr1g0365941 RchiOBHm_Chr3g0453341 RchiOBHm_Chr4g0388371 RchiOBHm_Chr4g0394021 RchiOBHm_Chr5g0013181 RchiOBHm_Chr6g0261721 RchiOBHm_Chr6g0261731 RchiOBHm_Chr7g0188861 RchiOBHm_Chr7g0192331 RchiOBHm_Chr7g0231721
rosa_multiflora Rmu_sc0002521.1_g000006 Rmu_sc0003255.1_g000026 Rmu_sc0004191.1_g000036 Rmu_sc0004414.1_g000014 Rmu_sc0005670.1_g000006 Rmu_sc0006081.1_g000001 Rmu_sc0007215.1_g000004 Rmu_sc0010088.1_g000010 Rmu_sc0020285.1_g000003 Rmu_sc0026896.1_g000002 Rmu_ssc0000019.1_g000029
rosa_roxburghii Rroxscaffold_3G00224890 Rroxscaffold_6G00400640 Rroxscaffold_7G00176590 Rroxscaffold_7G00189230
rosa_samantha Rh4BG046700
rosa_wichuraiana Rw1G012690 Rw1G031370 Rw2G042180 Rw2G043670 Rw2G046240 Rw2G049890 Rw2G050760 Rw2G051280 Rw2G053590 Rw3G007590 Rw3G026850 Rw4G001540 Rw4G009760 Rw4G019270 Rw5G000720 Rw5G005620 Rw5G041560 Rw6G007370 Rw6G009830 Rw6G015360 Rw6G031160 Rw7G004930 Rw7G011010 Rw7G024230 Rw7G028240

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 4 cut(s) 256, 290, 383, 454
AcuI CTGAAG 1 cut(s) 197
AdeI CACNNNGTG 1 cut(s) 377
AfaI GTAC 1 cut(s) 74
AfiI CCNNNNNNNGG 1 cut(s) 351
AflIII ACRYGT 1 cut(s) 124
AgsI TTSAA 5 cut(s) 97, 158, 359, 430, 489
AhlI ACTAGT 2 cut(s) 14, 236
AjnI CCWGG 2 cut(s) 225, 349
AluBI AGCT 3 cut(s) 35, 65, 105
AluI AGCT 3 cut(s) 35, 65, 105
Alw26I GTCTC 1 cut(s) 79
AlwNI CAGNNNCTG 1 cut(s) 108
AoxI GGCC 1 cut(s) 361
ApeKI GCWGC 3 cut(s) 102, 230, 296
ApoI RAATTY 4 cut(s) 256, 290, 383, 454
Asp700I GAANNNNTTC 1 cut(s) 190
AsuHPI GGTGA 4 cut(s) 253, 344, 388, 425
BaeGI GKGCMC 1 cut(s) 544
BbsI GAAGAC 1 cut(s) 410
BbvI GCAGC 3 cut(s) 114, 242, 283
BciT130I CCWGG 2 cut(s) 227, 351
BcoDI GTCTC 1 cut(s) 79
BcuI ACTAGT 2 cut(s) 14, 236
BfaI CTAG 3 cut(s) 15, 30, 237
BisI GCNGC 3 cut(s) 103, 231, 297
BlsI GCNGC 3 cut(s) 104, 232, 298
Bme1390I CCNGG 2 cut(s) 227, 351
BmiI GGNNCC 1 cut(s) 531
BmrFI CCNGG 2 cut(s) 227, 351
BmsI GCATC 1 cut(s) 29
BpiI GAAGAC 1 cut(s) 410
Bpu10I CCTNAGC 1 cut(s) 66
BsaBI GATNNNNATC 1 cut(s) 507
BsaI GGTCTC 1 cut(s) 79
BsaJI CCNNGG 4 cut(s) 350, 376, 468, 533
Bsc4I CCNNNNNNNGG 1 cut(s) 351
Bse8I GATNNNNATC 1 cut(s) 507
BseBI CCWGG 2 cut(s) 227, 351
BseDI CCNNGG 4 cut(s) 350, 376, 468, 533
BseJI GATNNNNATC 1 cut(s) 507
BseLI CCNNNNNNNGG 1 cut(s) 351
BseMII CTCAG 2 cut(s) 234, 319
BseSI GKGCMC 1 cut(s) 544
BseXI GCAGC 3 cut(s) 114, 242, 283
BseYI CCCAGC 1 cut(s) 55
BsgI GTGCAG 1 cut(s) 354
BshFI GGCC 1 cut(s) 363
BslI CCNNNNNNNGG 1 cut(s) 351
BsmAI GTCTC 1 cut(s) 79
BsnI GGCC 1 cut(s) 363
Bso31I GGTCTC 1 cut(s) 79
Bsp1286I GDGCHC 1 cut(s) 544
Bsp1407I TGTACA 1 cut(s) 72
Bsp143I GATC 3 cut(s) 388, 491, 502
BspANI GGCC 1 cut(s) 363
BspCNI CTCAG 2 cut(s) 235, 318
BspLI GGNNCC 1 cut(s) 531
BspTNI GGTCTC 1 cut(s) 79
BsrGI TGTACA 1 cut(s) 72
BssECI CCNNGG 4 cut(s) 350, 376, 468, 533
BssMI GATC 3 cut(s) 388, 491, 502
BssT1I CCWWGG 1 cut(s) 468
Bst2UI CCWGG 2 cut(s) 227, 351
Bst4CI ACNGT 1 cut(s) 110
BstAUI TGTACA 1 cut(s) 72
BstDEI CTNAG 4 cut(s) 9, 66, 243, 305
BstDSI CCRYGG 2 cut(s) 376, 533
BstKTI GATC 3 cut(s) 391, 494, 505
BstMAI GTCTC 1 cut(s) 79
BstMBI GATC 3 cut(s) 388, 491, 502
BstMWI GCNNNNNNNGC 2 cut(s) 41, 227
BstNI CCWGG 2 cut(s) 227, 351
BstNSI RCATGY 1 cut(s) 128
BstSCI CCNGG 2 cut(s) 225, 349
BstSLI GKGCMC 1 cut(s) 544
BstV1I GCAGC 3 cut(s) 114, 242, 283
BstV2I GAAGAC 1 cut(s) 410
BsuRI GGCC 1 cut(s) 363
BtgI CCRYGG 2 cut(s) 376, 533
BtsI GCAGTG 1 cut(s) 366
BtsIMutI CAGTG 1 cut(s) 366
CaiI CAGNNNCTG 1 cut(s) 108
Csp6I GTAC 1 cut(s) 73
CviAII CATG 3 cut(s) 125, 323, 346
CviJI RGCY 6 cut(s) 35, 65, 105, 166, 363, 530
CviKI_1 RGCY 6 cut(s) 35, 65, 105, 166, 363, 530
CviQI GTAC 1 cut(s) 73
DdeI CTNAG 4 cut(s) 9, 66, 243, 305
DpnI GATC 3 cut(s) 390, 493, 504
DpnII GATC 3 cut(s) 388, 491, 502
DraIII CACNNNGTG 1 cut(s) 377
Eco130I CCWWGG 1 cut(s) 468
Eco31I GGTCTC 1 cut(s) 79
Eco57I CTGAAG 1 cut(s) 197
EcoRI GAATTC 1 cut(s) 454
EcoRII CCWGG 2 cut(s) 225, 349
EcoT14I CCWWGG 1 cut(s) 468
EcoT22I ATGCAT 1 cut(s) 324
ErhI CCWWGG 1 cut(s) 468
FaeI CATG 3 cut(s) 128, 326, 349
FaiI YATR 9 cut(s) 39, 126, 251, 318, 320, 324, 347, 514, 519
FatI CATG 3 cut(s) 124, 322, 345
FauNDI CATATG 1 cut(s) 318
Fnu4HI GCNGC 3 cut(s) 103, 231, 297
Fsp4HI GCNGC 3 cut(s) 103, 231, 297
FspBI CTAG 3 cut(s) 15, 30, 237
GluI GCNGC 3 cut(s) 103, 231, 297
GsaI CCCAGC 1 cut(s) 59
HaeIII GGCC 1 cut(s) 363
Hin1II CATG 3 cut(s) 128, 326, 349
HinfI GANTC 2 cut(s) 208, 464
HphI GGTGA 4 cut(s) 253, 344, 388, 425
Hpy166II GTNNAC 1 cut(s) 73
Hpy188I TCNGA 3 cut(s) 25, 177, 244
Hpy188III TCNNGA 2 cut(s) 155, 489
Hpy8I GTNNAC 1 cut(s) 73
HpyAV CCTTC 4 cut(s) 172, 176, 353, 410
HpyCH4III ACNGT 1 cut(s) 110
HpyCH4V TGCA 4 cut(s) 20, 102, 322, 371
HpyF10VI GCNNNNNNNGC 2 cut(s) 41, 227
HpyF3I CTNAG 4 cut(s) 9, 66, 243, 305
Hsp92II CATG 3 cut(s) 128, 326, 349
Kzo9I GATC 3 cut(s) 388, 491, 502
LmnI GCTCC 1 cut(s) 535
LpnPI CCDG 7 cut(s) 69, 102, 115, 212, 239, 336, 363
Lsp1109I GCAGC 3 cut(s) 114, 242, 283
LweI GCATC 1 cut(s) 29
MaeI CTAG 3 cut(s) 15, 30, 237
MalI GATC 3 cut(s) 390, 493, 504
MboI GATC 3 cut(s) 388, 491, 502
MboII GAAGA 2 cut(s) 347, 415
MhlI GDGCHC 1 cut(s) 544
MluCI AATT 4 cut(s) 256, 290, 383, 454
MmeI TCCRAC 1 cut(s) 185
MnlI CCTC 5 cut(s) 106, 238, 274, 323, 554
Mph1103I ATGCAT 1 cut(s) 324
MroXI GAANNNNTTC 1 cut(s) 190
MseI TTAA 1 cut(s) 281
MslI CAYNNNNRTG 1 cut(s) 321
MspR9I CCNGG 2 cut(s) 227, 351
MvaI CCWGG 2 cut(s) 227, 351
MwoI GCNNNNNNNGC 2 cut(s) 41, 227
NdeI CATATG 1 cut(s) 318
NdeII GATC 3 cut(s) 388, 491, 502
NlaIII CATG 3 cut(s) 128, 326, 349
NlaIV GGNNCC 1 cut(s) 531
NsiI ATGCAT 1 cut(s) 324
NspI RCATGY 1 cut(s) 128
PciI ACATGT 1 cut(s) 124
PdmI GAANNNNTTC 1 cut(s) 190
PfeI GAWTC 2 cut(s) 208, 464
PkrI GCNGC 3 cut(s) 104, 232, 298
PscI ACATGT 1 cut(s) 124
Psp6I CCWGG 2 cut(s) 225, 349
PspFI CCCAGC 1 cut(s) 55
PspGI CCWGG 2 cut(s) 225, 349
PspN4I GGNNCC 1 cut(s) 531
PstNI CAGNNNCTG 1 cut(s) 108
RsaI GTAC 1 cut(s) 74
RsaNI GTAC 1 cut(s) 73
RseI CAYNNNNRTG 1 cut(s) 321
SaqAI TTAA 1 cut(s) 281
SatI GCNGC 3 cut(s) 103, 231, 297
Sau3AI GATC 3 cut(s) 388, 491, 502
ScrFI CCNGG 2 cut(s) 227, 351
SduI GDGCHC 1 cut(s) 544
SfaNI GCATC 1 cut(s) 29
SmiMI CAYNNNNRTG 1 cut(s) 321
SpeI ACTAGT 2 cut(s) 14, 236
Sse9I AATT 4 cut(s) 256, 290, 383, 454
SspMI CTAG 3 cut(s) 15, 30, 237
StyD4I CCNGG 2 cut(s) 225, 349
StyI CCWWGG 1 cut(s) 468
TaaI ACNGT 1 cut(s) 110
TasI AATT 4 cut(s) 256, 290, 383, 454
TatI WGTACW 1 cut(s) 72
TfiI GAWTC 2 cut(s) 208, 464
Tru1I TTAA 1 cut(s) 281
Tru9I TTAA 1 cut(s) 281
TscAI CASTG 1 cut(s) 373
TseI GCWGC 3 cut(s) 102, 230, 296
TspDTI ATGAA 2 cut(s) 303, 543
TspGWI ACGGA 2 cut(s) 365, 522
TspRI CASTG 1 cut(s) 373
XapI RAATTY 4 cut(s) 256, 290, 383, 454
XceI RCATGY 1 cut(s) 128
XmnI GAANNNNTTC 1 cut(s) 190
XspI CTAG 3 cut(s) 15, 30, 237
Zsp2I ATGCAT 1 cut(s) 324
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.