Rroxscaffold_7G00176590

transposition, RNA-mediated

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
OG0000562
Physical Location & Seq
Reverse (-)
16177890 .. 16180470
2581 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00176590.1

Sequence Viewer

Length: 198 bp
ATGTCATGGCTCCTAAACTCTATGGAGCCATCTATTGCTTCCATCTTTAGCTATTCTAAGTCTTCTCATCATATTTGGACTACTGTGAAGGAGAAGCATGGTAACCAAAATAATTGTGCCGAATTTTGCAAATTCAAAGAGACATCACCAGTCTCAAACAAGGAGCAAACTCTTTTGTTCACCATCTTGGCAAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Retrotran_gag_2 rve

Protein Analysis

65

Amino Acids

7.45

Weight (kDa)

8.69

Isoelectric Point (pI)

43.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000562)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g17331 FvH4_3g36541
malus_domestica MD07G1078600.v1.1 MD10G1237700.v1.1 MD10G1333400.v1.1 MD11G1102200.v1.1 MD13G1138400.v1.1 MD14G1033400.v1.1 MD15G1053300.v1.1
prunus_persica Prupe.1G465400_v2.0.a1 Prupe.3G136000_v2.0.a1 Prupe.7G119900_v2.0.a1
pyrus_communis pycom01g04630 pycom03g13050 pycom04g21190 pycom05g04910 pycom05g05510 pycom08g15850 pycom09g15040 pycom1094g00010 pycom11g02000 pycom12g06150 pycom13g24110 pycom13g24910 pycom14g00050 pycom15g21970 pycom15g35170 pycom15g35180 pycom16g14620 pycom16g14630 pycom808g00110
rosa_chinensis RchiOBHm_Chr1g0322851 RchiOBHm_Chr1g0365941 RchiOBHm_Chr3g0453341 RchiOBHm_Chr4g0388371 RchiOBHm_Chr4g0394021 RchiOBHm_Chr5g0013181 RchiOBHm_Chr6g0261721 RchiOBHm_Chr6g0261731 RchiOBHm_Chr7g0188861 RchiOBHm_Chr7g0192331 RchiOBHm_Chr7g0231721
rosa_multiflora Rmu_sc0002521.1_g000006 Rmu_sc0003255.1_g000026 Rmu_sc0004191.1_g000036 Rmu_sc0004414.1_g000014 Rmu_sc0005670.1_g000006 Rmu_sc0006081.1_g000001 Rmu_sc0007215.1_g000004 Rmu_sc0010088.1_g000010 Rmu_sc0020285.1_g000003 Rmu_sc0026896.1_g000002 Rmu_ssc0000019.1_g000029
rosa_roxburghii Rroxscaffold_3G00224890 Rroxscaffold_6G00400640 Rroxscaffold_7G00176590 Rroxscaffold_7G00189230
rosa_samantha Rh4BG046700
rosa_wichuraiana Rw1G012690 Rw1G031370 Rw2G042180 Rw2G043670 Rw2G046240 Rw2G049890 Rw2G050760 Rw2G051280 Rw2G053590 Rw3G007590 Rw3G026850 Rw4G001540 Rw4G009760 Rw4G019270 Rw5G000720 Rw5G005620 Rw5G041560 Rw6G007370 Rw6G009830 Rw6G015360 Rw6G031160 Rw7G004930 Rw7G011010 Rw7G024230 Rw7G028240

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 122, 131
AgsI TTSAA 1 cut(s) 136
AluBI AGCT 1 cut(s) 51
AluI AGCT 1 cut(s) 51
Alw26I GTCTC 2 cut(s) 134, 157
ApoI RAATTY 2 cut(s) 122, 131
AsuHPI GGTGA 2 cut(s) 138, 172
BbsI GAAGAC 1 cut(s) 54
BccI CCATC 3 cut(s) 37, 50, 191
BcoDI GTCTC 2 cut(s) 134, 157
BmiI GGNNCC 2 cut(s) 11, 27
BpiI GAAGAC 1 cut(s) 54
Bse1I ACTGG 1 cut(s) 149
BseNI ACTGG 1 cut(s) 149
BsmAI GTCTC 2 cut(s) 134, 157
BspLI GGNNCC 2 cut(s) 11, 27
BsrI ACTGG 1 cut(s) 149
Bst4CI ACNGT 1 cut(s) 85
BstDEI CTNAG 1 cut(s) 57
BstEII GGTNACC 1 cut(s) 101
BstMAI GTCTC 2 cut(s) 134, 157
BstPI GGTNACC 1 cut(s) 101
BstV2I GAAGAC 1 cut(s) 54
CviAII CATG 2 cut(s) 6, 98
CviJI RGCY 3 cut(s) 10, 28, 51
CviKI_1 RGCY 3 cut(s) 10, 28, 51
DdeI CTNAG 1 cut(s) 57
Eco91I GGTNACC 1 cut(s) 101
EcoO65I GGTNACC 1 cut(s) 101
FaeI CATG 2 cut(s) 9, 101
FaiI YATR 4 cut(s) 7, 23, 72, 99
FatI CATG 2 cut(s) 5, 97
Hin1II CATG 2 cut(s) 9, 101
HphI GGTGA 2 cut(s) 138, 172
Hpy166II GTNNAC 1 cut(s) 180
Hpy8I GTNNAC 1 cut(s) 180
HpyAV CCTTC 1 cut(s) 82
HpyCH4III ACNGT 1 cut(s) 85
HpyCH4V TGCA 1 cut(s) 129
HpyF3I CTNAG 1 cut(s) 57
Hsp92II CATG 2 cut(s) 9, 101
LmnI GCTCC 3 cut(s) 15, 25, 163
LpnPI CCDG 1 cut(s) 162
MaeIII GTNAC 1 cut(s) 101
MboII GAAGA 1 cut(s) 54
MluCI AATT 3 cut(s) 112, 122, 131
NlaIII CATG 2 cut(s) 9, 101
NlaIV GGNNCC 2 cut(s) 11, 27
PspEI GGTNACC 1 cut(s) 101
PspN4I GGNNCC 2 cut(s) 11, 27
SetI ASST 1 cut(s) 53
SgeI CNNG 4 cut(s) 18, 110, 161, 172
Sse9I AATT 3 cut(s) 112, 122, 131
TaaI ACNGT 1 cut(s) 85
TasI AATT 3 cut(s) 112, 122, 131
XapI RAATTY 2 cut(s) 122, 131
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.