FvH4_6g21972
MYB Family

nuclease HARBI1

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb6
OG0000468
Physical Location & Seq
Reverse (-)
15664771 .. 15664971
201 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_6g21972.t1

Sequence Viewer

Length: 201 bp
ATGGAATATGCAGTATTTGAGTTTGATCAGTTAGCAGATATGGAAAATGTTGATATGATTGACTCTACTGAAGCATCAGATCAATGGACGGCATGGAGGAATGAGAAAGCCTCTCAAATGTTTGATGATTGGACAAGACGTAGGAATGATAGAGGTGGTGGTAGAGGCAGTGCTAGGGGCGGTGCTAGAGGCCGTGCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DDE_Tnp_4 Myb_DNA-bind_3

Protein Analysis

67

Amino Acids

7.58

Weight (kDa)

4.76

Isoelectric Point (pI)

36.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000468)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g04030 FvH4_2g09411 FvH4_3g15551 FvH4_3g36421 FvH4_4g11701 FvH4_5g36381 FvH4_6g09143 FvH4_6g09144 FvH4_6g21972
malus_domestica MD00G1096500.v1.1 MD00G1122500.v1.1 MD02G1090600.v1.1 MD02G1173300.v1.1 MD05G1202800.v1.1 MD14G1123600.v1.1
prunus_persica Prupe.1G083600_v2.0.a1 Prupe.1G245300_v2.0.a1 Prupe.5G002100_v2.0.a1 Prupe.6G061200_v2.0.a1
pyrus_communis pycom01g07060 pycom02g13920 pycom04g11780 pycom04g13480 pycom04g21940 pycom06g07950 pycom07g03740 pycom07g03980 pycom09g02010 pycom09g02020 pycom09g11510 pycom09g14260 pycom10g02500 pycom10g15690 pycom12g08730 pycom12g08740 pycom14g19840 pycom15g16780 pycom15g24940 pycom15g25660 pycom16g21630 pycom16g26320
rosa_chinensis RchiOBHm_Chr1g0330371 RchiOBHm_Chr1g0331991 RchiOBHm_Chr6g0300321
rosa_laevigata RLG00000013795
rosa_multiflora Rmu_sc0000060.1_g000010 Rmu_sc0000288.1_g000044 Rmu_sc0002219.1_g000002 Rmu_sc0003995.1_g000003
rosa_roxburghii Rroxscaffold_1G00059020 Rroxscaffold_2G00108450 Rroxscaffold_2G00112460 Rroxscaffold_5G00375700 Rroxscaffold_5G00381640 Rroxscaffold_7G00158590
rosa_rugosa Rorug01G0237300 Rorug01G0237400 Rorug01G0237500 Rorug02G0051900 Rorug03G0260600 Rorug03G0285800 Rorug04G0076800 Rorug04G0162600 Rorug07G0264500 Rorug07G0264500
rosa_samantha Rh2DG003500 Rh3CG244800 Rh4CG334200 Rh5AG318300 Rh5BG549000 Rh7AG126400 Rh7CG118500 Rh7CG154500 Rh7DG025400
rosa_wichuraiana Rw1G026390 Rw2G005400 Rw2G034490 Rw3G019530 Rw3G028000 Rw4G010490 Rw5G010830 Rw5G023340 Rw5G026580 Rw5G041150 Rw6G003010 Rw6G003290 Rw6G010630 Rw6G021220 Rw6G035650 Rw7G014310

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 180
AcuI CTGAAG 1 cut(s) 90
AoxI GGCC 1 cut(s) 190
BceAI ACGGC 2 cut(s) 105, 177
BclI TGATCA 1 cut(s) 25
BfaI CTAG 2 cut(s) 174, 186
BmsI GCATC 1 cut(s) 83
BplI GAGNNNNNCTC 2 cut(s) 95, 127
BshFI GGCC 1 cut(s) 192
BsnI GGCC 1 cut(s) 192
Bsp143I GATC 2 cut(s) 25, 79
BspACI CCGC 1 cut(s) 180
BspANI GGCC 1 cut(s) 192
BssMI GATC 2 cut(s) 25, 79
BstDEI CTNAG 1 cut(s) 198
BstKTI GATC 2 cut(s) 28, 82
BstMBI GATC 2 cut(s) 25, 79
BsuRI GGCC 1 cut(s) 192
BtsI GCAGTG 1 cut(s) 175
BtsIMutI CAGTG 1 cut(s) 175
CviAII CATG 1 cut(s) 93
CviJI RGCY 2 cut(s) 110, 192
CviKI_1 RGCY 2 cut(s) 110, 192
DdeI CTNAG 1 cut(s) 198
DpnI GATC 2 cut(s) 27, 81
DpnII GATC 2 cut(s) 25, 79
Eco57I CTGAAG 1 cut(s) 90
FaeI CATG 1 cut(s) 96
FaiI YATR 4 cut(s) 9, 41, 56, 94
FatI CATG 1 cut(s) 92
FbaI TGATCA 1 cut(s) 25
FspBI CTAG 2 cut(s) 174, 186
HaeIII GGCC 1 cut(s) 192
Hin1II CATG 1 cut(s) 96
HinfI GANTC 1 cut(s) 62
Hpy188I TCNGA 1 cut(s) 79
HpyCH4IV ACGT 1 cut(s) 139
HpyCH4V TGCA 1 cut(s) 11
HpyF3I CTNAG 1 cut(s) 198
HpySE526I ACGT 1 cut(s) 139
Hsp92II CATG 1 cut(s) 96
Ksp22I TGATCA 1 cut(s) 25
Kzo9I GATC 2 cut(s) 25, 79
LweI GCATC 1 cut(s) 83
MaeI CTAG 2 cut(s) 174, 186
MaeII ACGT 1 cut(s) 139
MalI GATC 2 cut(s) 27, 81
MboI GATC 2 cut(s) 25, 79
MlyI GAGTC 1 cut(s) 56
MnlI CCTC 5 cut(s) 90, 121, 146, 158, 182
NdeII GATC 2 cut(s) 25, 79
NlaIII CATG 1 cut(s) 96
PleI GAGTC 1 cut(s) 56
PpsI GAGTC 1 cut(s) 56
Sau3AI GATC 2 cut(s) 25, 79
SchI GAGTC 1 cut(s) 56
SetI ASST 2 cut(s) 142, 157
SfaNI GCATC 1 cut(s) 83
SgeI CNNG 3 cut(s) 105, 147, 186
SsiI CCGC 1 cut(s) 180
SspMI CTAG 2 cut(s) 174, 186
TaiI ACGT 1 cut(s) 142
TscAI CASTG 1 cut(s) 175
TspRI CASTG 1 cut(s) 175
XspI CTAG 2 cut(s) 174, 186
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.