Rh7CG118500
MYB Family

Myb/SANT-like DNA-binding domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
OG0000468
Physical Location & Seq
Forward (+)
9077090 .. 9077645
556 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG118500.1

Sequence Viewer

Length: 462 bp
ATGGAAAACTTAAGAGTTAGCAGATATGGATTTTCAAAACTTTGCCAAGTCTTATATGACAAAGGTGGATTACGAAGAACAAGGCATGTATCTATTGAAGAATCTGTGGCCATATTTTTAAATATCCTTGGGCATGACGTGAAGTATAGATCCATTCATTTGAACTTTTATCACTCCAAAGAAACTATAAGTAGACAATTTAATAGAGTGTTGCGTGCAGTAATGAGAACTAGTAAGGAATATGTGAGGTTTCATGATTGTGTTCTCCAAGGAGCTGACTTGAGAAGATGGAGATGGTTTGAGAATTATCTTGGAGCTTTAGATGAAACCCACGTCTCTGTAATTGTTCAAGCTGTGGAACGACCTAGATACCGGAATAGGAAGGGAGATATTTCTTCTAATTTTTTGGGAGCTTGCAATCCAAACATGAGATTCTCGACTTCTATGAGATGCATTATCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DDE_Tnp_4 Myb_DNA-bind_3

Protein Analysis

153

Amino Acids

18.12

Weight (kDa)

10.08

Isoelectric Point (pI)

47.64

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF8040 PF26138 2 - 75 2.2e-23 Domain of unknown function (DUF8040)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000468)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g04030 FvH4_2g09411 FvH4_3g15551 FvH4_3g36421 FvH4_4g11701 FvH4_5g36381 FvH4_6g09143 FvH4_6g09144 FvH4_6g21972
malus_domestica MD00G1096500.v1.1 MD00G1122500.v1.1 MD02G1090600.v1.1 MD02G1173300.v1.1 MD05G1202800.v1.1 MD14G1123600.v1.1
prunus_persica Prupe.1G083600_v2.0.a1 Prupe.1G245300_v2.0.a1 Prupe.5G002100_v2.0.a1 Prupe.6G061200_v2.0.a1
pyrus_communis pycom01g07060 pycom02g13920 pycom04g11780 pycom04g13480 pycom04g21940 pycom06g07950 pycom07g03740 pycom07g03980 pycom09g02010 pycom09g02020 pycom09g11510 pycom09g14260 pycom10g02500 pycom10g15690 pycom12g08730 pycom12g08740 pycom14g19840 pycom15g16780 pycom15g24940 pycom15g25660 pycom16g21630 pycom16g26320
rosa_chinensis RchiOBHm_Chr1g0330371 RchiOBHm_Chr1g0331991 RchiOBHm_Chr6g0300321
rosa_laevigata RLG00000013795
rosa_multiflora Rmu_sc0000060.1_g000010 Rmu_sc0000288.1_g000044 Rmu_sc0002219.1_g000002 Rmu_sc0003995.1_g000003
rosa_roxburghii Rroxscaffold_1G00059020 Rroxscaffold_2G00108450 Rroxscaffold_2G00112460 Rroxscaffold_5G00375700 Rroxscaffold_5G00381640 Rroxscaffold_7G00158590
rosa_rugosa Rorug01G0237300 Rorug01G0237400 Rorug01G0237500 Rorug02G0051900 Rorug03G0260600 Rorug03G0285800 Rorug04G0076800 Rorug04G0162600 Rorug07G0264500 Rorug07G0264500
rosa_samantha Rh2DG003500 Rh3CG244800 Rh4CG334200 Rh5AG318300 Rh5BG549000 Rh7AG126400 Rh7CG118500 Rh7CG154500 Rh7DG025400
rosa_wichuraiana Rw1G026390 Rw2G005400 Rw2G034490 Rw3G019530 Rw3G028000 Rw4G010490 Rw5G010830 Rw5G023340 Rw5G026580 Rw5G041150 Rw6G003010 Rw6G003290 Rw6G010630 Rw6G021220 Rw6G035650 Rw7G014310

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 193
AclWI GGATC 1 cut(s) 144
AcoI YGGCCR 1 cut(s) 108
AflII CTTAAG 1 cut(s) 10
AgsI TTSAA 4 cut(s) 36, 98, 163, 350
AhlI ACTAGT 1 cut(s) 230
AjiI CACGTC 2 cut(s) 139, 334
AluBI AGCT 4 cut(s) 275, 317, 353, 413
AluI AGCT 4 cut(s) 275, 317, 353, 413
Alw26I GTCTC 1 cut(s) 340
AlwI GGATC 1 cut(s) 144
AoxI GGCC 1 cut(s) 108
BalI TGGCCA 1 cut(s) 110
BccI CCATC 2 cut(s) 282, 288
BcoDI GTCTC 1 cut(s) 340
BcuI ACTAGT 1 cut(s) 230
BfaI CTAG 3 cut(s) 231, 366, 460
BfrI CTTAAG 1 cut(s) 10
BmgBI CACGTC 2 cut(s) 139, 334
BmsI GCATC 1 cut(s) 440
BpuEI CTTGAG 1 cut(s) 301
BsaJI CCNNGG 2 cut(s) 127, 268
BsaWI WCCGGW 1 cut(s) 372
BseDI CCNNGG 2 cut(s) 127, 268
BsgI GTGCAG 1 cut(s) 237
BshFI GGCC 1 cut(s) 110
BsiSI CCGG 1 cut(s) 373
BsmAI GTCTC 1 cut(s) 340
BsmBI CGTCTC 1 cut(s) 340
BsnI GGCC 1 cut(s) 110
Bsp143I GATC 1 cut(s) 149
BspANI GGCC 1 cut(s) 110
BspHI TCATGA 1 cut(s) 253
BspPI GGATC 1 cut(s) 144
BspTI CTTAAG 1 cut(s) 10
BssECI CCNNGG 2 cut(s) 127, 268
BssMI GATC 1 cut(s) 149
BssT1I CCWWGG 2 cut(s) 127, 268
BstAFI CTTAAG 1 cut(s) 10
BstC8I GCNNGC 2 cut(s) 216, 415
BstKTI GATC 1 cut(s) 152
BstMAI GTCTC 1 cut(s) 340
BstMBI GATC 1 cut(s) 149
BstNSI RCATGY 1 cut(s) 89
BstX2I RGATCY 1 cut(s) 149
BstYI RGATCY 1 cut(s) 149
BsuRI GGCC 1 cut(s) 110
BtrI CACGTC 2 cut(s) 139, 334
Cac8I GCNNGC 2 cut(s) 216, 415
CciI TCATGA 1 cut(s) 253
CviAII CATG 4 cut(s) 86, 134, 254, 427
CviJI RGCY 5 cut(s) 110, 275, 317, 353, 413
CviKI_1 RGCY 5 cut(s) 110, 275, 317, 353, 413
DpnI GATC 1 cut(s) 151
DpnII GATC 1 cut(s) 149
DraI TTTAAA 1 cut(s) 120
EaeI YGGCCR 1 cut(s) 108
Eco130I CCWWGG 2 cut(s) 127, 268
EcoT14I CCWWGG 2 cut(s) 127, 268
EcoT22I ATGCAT 1 cut(s) 455
ErhI CCWWGG 2 cut(s) 127, 268
Esp3I CGTCTC 1 cut(s) 340
FaeI CATG 4 cut(s) 89, 137, 257, 430
FatI CATG 4 cut(s) 85, 133, 253, 426
FblI GTMKAC 1 cut(s) 193
FspBI CTAG 3 cut(s) 231, 366, 460
HaeIII GGCC 1 cut(s) 110
HapII CCGG 1 cut(s) 373
Hin1II CATG 4 cut(s) 89, 137, 257, 430
HinfI GANTC 2 cut(s) 101, 432
HpaII CCGG 1 cut(s) 373
Hpy166II GTNNAC 1 cut(s) 194
Hpy188III TCNNGA 2 cut(s) 254, 436
Hpy8I GTNNAC 1 cut(s) 194
HpyAV CCTTC 1 cut(s) 376
HpyCH4IV ACGT 2 cut(s) 138, 333
HpyCH4V TGCA 3 cut(s) 218, 417, 453
HpySE526I ACGT 2 cut(s) 138, 333
Hsp92II CATG 4 cut(s) 89, 137, 257, 430
Kzo9I GATC 1 cut(s) 149
LmnI GCTCC 3 cut(s) 272, 314, 410
LpnPI CCDG 1 cut(s) 386
LweI GCATC 1 cut(s) 440
MaeI CTAG 3 cut(s) 231, 366, 460
MaeII ACGT 2 cut(s) 138, 333
MalI GATC 1 cut(s) 151
MboI GATC 1 cut(s) 149
MboII GAAGA 4 cut(s) 87, 110, 297, 387
MflI RGATCY 1 cut(s) 149
MlsI TGGCCA 1 cut(s) 110
MluCI AATT 4 cut(s) 197, 304, 342, 400
MluNI TGGCCA 1 cut(s) 110
MnlI CCTC 1 cut(s) 240
Mox20I TGGCCA 1 cut(s) 110
Mph1103I ATGCAT 1 cut(s) 455
MscI TGGCCA 1 cut(s) 110
MseI TTAA 3 cut(s) 11, 119, 201
MslI CAYNNNNRTG 1 cut(s) 258
Msp20I TGGCCA 1 cut(s) 110
MspCI CTTAAG 1 cut(s) 10
MspI CCGG 1 cut(s) 373
NdeII GATC 1 cut(s) 149
NlaIII CATG 4 cut(s) 89, 137, 257, 430
NsiI ATGCAT 1 cut(s) 455
NspI RCATGY 1 cut(s) 89
PagI TCATGA 1 cut(s) 253
PfeI GAWTC 2 cut(s) 101, 432
PsuI RGATCY 1 cut(s) 149
RseI CAYNNNNRTG 1 cut(s) 258
SaqAI TTAA 3 cut(s) 11, 119, 201
Sau3AI GATC 1 cut(s) 149
SetI ASST 9 cut(s) 67, 141, 251, 277, 319, 336, 355, 367, 415
SfaNI GCATC 1 cut(s) 440
SmiMI CAYNNNNRTG 1 cut(s) 258
SmlI CTYRAG 2 cut(s) 10, 280
SmoI CTYRAG 2 cut(s) 10, 280
SpeI ACTAGT 1 cut(s) 230
Sse9I AATT 4 cut(s) 197, 304, 342, 400
SspMI CTAG 3 cut(s) 231, 366, 460
StyI CCWWGG 2 cut(s) 127, 268
TaiI ACGT 2 cut(s) 141, 336
TaqI TCGA 1 cut(s) 437
TasI AATT 4 cut(s) 197, 304, 342, 400
TfiI GAWTC 2 cut(s) 101, 432
Tru1I TTAA 3 cut(s) 11, 119, 201
Tru9I TTAA 3 cut(s) 11, 119, 201
TspDTI ATGAA 3 cut(s) 146, 242, 339
Vha464I CTTAAG 1 cut(s) 10
XceI RCATGY 1 cut(s) 89
XmiI GTMKAC 1 cut(s) 193
XspI CTAG 3 cut(s) 231, 366, 460
Zsp2I ATGCAT 1 cut(s) 455
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.