pycom12g08740
MYB Family

nuclease HARBI1

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr12
Physical Location & Seq
Forward (+)
10281852 .. 10282197
346 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom12g08740.2

Sequence Viewer

Length: 222 bp
ATGTTGGGAGTCTGTAATGTGGACATGAATTTTATATTTGTGTACCCAGGTTGGGAAGTGTCGGCATCTGATTCTAGAGTACTCCGAGGTGCGATAAGTAGACCATTGGCATTAAAAGTTCCCACGGGGTGTTACTACCTTGTGGATGGTGGGTACACAAATGGTCCAGGATACCTTGCACCGTATAGGGGAGTGTGTTACCATCTCTCGGATTCAATATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

74

Amino Acids

7.97

Weight (kDa)

6.5

Isoelectric Point (pI)

15.31

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000468)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g04030 FvH4_2g09411 FvH4_3g15551 FvH4_3g36421 FvH4_4g11701 FvH4_5g36381 FvH4_6g09143 FvH4_6g09144 FvH4_6g21972
malus_domestica MD00G1096500.v1.1 MD00G1122500.v1.1 MD02G1090600.v1.1 MD02G1173300.v1.1 MD05G1202800.v1.1 MD14G1123600.v1.1
prunus_persica Prupe.1G083600_v2.0.a1 Prupe.1G245300_v2.0.a1 Prupe.5G002100_v2.0.a1 Prupe.6G061200_v2.0.a1
pyrus_communis pycom01g07060 pycom02g13920 pycom04g11780 pycom04g13480 pycom04g21940 pycom06g07950 pycom07g03740 pycom07g03980 pycom09g02010 pycom09g02020 pycom09g11510 pycom09g14260 pycom10g02500 pycom10g15690 pycom12g08730 pycom12g08740 pycom14g19840 pycom15g16780 pycom15g24940 pycom15g25660 pycom16g21630 pycom16g26320
rosa_chinensis RchiOBHm_Chr1g0330371 RchiOBHm_Chr1g0331991 RchiOBHm_Chr6g0300321
rosa_laevigata RLG00000013795
rosa_multiflora Rmu_sc0000060.1_g000010 Rmu_sc0000288.1_g000044 Rmu_sc0002219.1_g000002 Rmu_sc0003995.1_g000003
rosa_roxburghii Rroxscaffold_1G00059020 Rroxscaffold_2G00108450 Rroxscaffold_2G00112460 Rroxscaffold_5G00375700 Rroxscaffold_5G00381640 Rroxscaffold_7G00158590
rosa_rugosa Rorug01G0237300 Rorug01G0237400 Rorug01G0237500 Rorug02G0051900 Rorug03G0260600 Rorug03G0285800 Rorug04G0076800 Rorug04G0162600 Rorug07G0264500 Rorug07G0264500
rosa_samantha Rh2DG003500 Rh3CG244800 Rh4CG334200 Rh5AG318300 Rh5BG549000 Rh7AG126400 Rh7CG118500 Rh7CG154500 Rh7DG025400
rosa_wichuraiana Rw1G026390 Rw2G005400 Rw2G034490 Rw3G019530 Rw3G028000 Rw4G010490 Rw5G010830 Rw5G023340 Rw5G026580 Rw5G041150 Rw6G003010 Rw6G003290 Rw6G010630 Rw6G021220 Rw6G035650 Rw7G014310

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 100
AcsI RAATTY 1 cut(s) 28
AdeI CACNNNGTG 1 cut(s) 129
AfaI GTAC 3 cut(s) 44, 81, 155
AfiI CCNNNNNNNGG 3 cut(s) 52, 188, 208
AgsI TTSAA 1 cut(s) 216
AjnI CCWGG 2 cut(s) 46, 166
ApoI RAATTY 1 cut(s) 28
AspS9I GGNCC 1 cut(s) 164
AvaII GGWCC 1 cut(s) 164
BccI CCATC 2 cut(s) 140, 210
BciT130I CCWGG 2 cut(s) 48, 168
BciVI GTATCC 1 cut(s) 164
BfaI CTAG 1 cut(s) 75
BfuI GTATCC 1 cut(s) 164
BmcAI AGTACT 1 cut(s) 81
Bme1390I CCNGG 2 cut(s) 48, 168
Bme18I GGWCC 1 cut(s) 164
BmgT120I GGNCC 1 cut(s) 164
BmrFI CCNGG 2 cut(s) 48, 168
BmsI GCATC 1 cut(s) 74
BsaJI CCNNGG 3 cut(s) 46, 85, 123
Bsc4I CCNNNNNNNGG 3 cut(s) 52, 188, 208
BseBI CCWGG 2 cut(s) 48, 168
BseDI CCNNGG 3 cut(s) 46, 85, 123
BseGI GGATG 1 cut(s) 151
BseLI CCNNNNNNNGG 3 cut(s) 52, 188, 208
BslI CCNNNNNNNGG 3 cut(s) 52, 188, 208
BssECI CCNNGG 3 cut(s) 46, 85, 123
Bst2UI CCWGG 2 cut(s) 48, 168
Bst4CI ACNGT 1 cut(s) 183
BstDSI CCRYGG 1 cut(s) 123
BstF5I GGATG 1 cut(s) 151
BstNI CCWGG 2 cut(s) 48, 168
BstSCI CCNGG 2 cut(s) 46, 166
BsuI GTATCC 1 cut(s) 164
BtgI CCRYGG 1 cut(s) 123
BtsCI GGATG 1 cut(s) 151
Cfr13I GGNCC 1 cut(s) 164
Csp6I GTAC 3 cut(s) 43, 80, 154
CviAII CATG 1 cut(s) 25
CviQI GTAC 3 cut(s) 43, 80, 154
DraIII CACNNNGTG 1 cut(s) 129
Eco47I GGWCC 1 cut(s) 164
EcoRII CCWGG 2 cut(s) 46, 166
FaeI CATG 1 cut(s) 28
FaiI YATR 4 cut(s) 26, 35, 186, 220
FatI CATG 1 cut(s) 24
FblI GTMKAC 1 cut(s) 100
FokI GGATG 1 cut(s) 158
FspBI CTAG 1 cut(s) 75
Hin1II CATG 1 cut(s) 28
HinfI GANTC 3 cut(s) 9, 71, 212
Hpy166II GTNNAC 4 cut(s) 22, 43, 101, 156
Hpy188I TCNGA 3 cut(s) 70, 86, 211
Hpy188III TCNNGA 1 cut(s) 75
Hpy8I GTNNAC 4 cut(s) 22, 43, 101, 156
HpyCH4III ACNGT 1 cut(s) 183
HpyCH4V TGCA 1 cut(s) 179
Hsp92II CATG 1 cut(s) 28
LpnPI CCDG 4 cut(s) 33, 60, 153, 180
LweI GCATC 1 cut(s) 74
MaeI CTAG 1 cut(s) 75
MaeIII GTNAC 2 cut(s) 131, 197
MluCI AATT 1 cut(s) 28
MlyI GAGTC 1 cut(s) 18
MnlI CCTC 1 cut(s) 80
MseI TTAA 1 cut(s) 113
MspR9I CCNGG 2 cut(s) 48, 168
MvaI CCWGG 2 cut(s) 48, 168
NlaIII CATG 1 cut(s) 28
PfeI GAWTC 2 cut(s) 71, 212
PfoI TCCNGGA 1 cut(s) 166
PleI GAGTC 1 cut(s) 17
PpsI GAGTC 1 cut(s) 17
Psp6I CCWGG 2 cut(s) 46, 166
PspGI CCWGG 2 cut(s) 46, 166
PspPI GGNCC 1 cut(s) 164
RsaI GTAC 3 cut(s) 44, 81, 155
RsaNI GTAC 3 cut(s) 43, 80, 154
SaqAI TTAA 1 cut(s) 113
Sau96I GGNCC 1 cut(s) 164
ScaI AGTACT 1 cut(s) 81
SchI GAGTC 1 cut(s) 18
ScrFI CCNGG 2 cut(s) 48, 168
SetI ASST 4 cut(s) 52, 91, 141, 177
SfaNI GCATC 1 cut(s) 74
SinI GGWCC 1 cut(s) 164
Sse9I AATT 1 cut(s) 28
SspMI CTAG 1 cut(s) 75
StyD4I CCNGG 2 cut(s) 46, 166
TaaI ACNGT 1 cut(s) 183
TasI AATT 1 cut(s) 28
TatI WGTACW 1 cut(s) 79
TfiI GAWTC 2 cut(s) 71, 212
Tru1I TTAA 1 cut(s) 113
Tru9I TTAA 1 cut(s) 113
TspDTI ATGAA 1 cut(s) 41
VpaK11BI GGWCC 1 cut(s) 164
XapI RAATTY 1 cut(s) 28
XbaI TCTAGA 1 cut(s) 74
XmiI GTMKAC 1 cut(s) 100
XspI CTAG 1 cut(s) 75
ZrmI AGTACT 1 cut(s) 81
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.