Rh3CG244800
ERF Family

DDE superfamily endonuclease

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3C
OG0000468
Physical Location & Seq
Reverse (-)
23533821 .. 23534309
489 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3CG244800.1

Sequence Viewer

Length: 489 bp
ATGGCTGTAATGAGTGTTGGTGATATTATAATGAGGTTAAAACGAAAGCGTGCCATAGAAGAAGAGGAAAATAAAAAGAGAATGAAAATTATTTTTGGTGCTACTGTATCTGTGATTGCTTTAATAATAGAGTGGTATCATAAGACATTTCTTGTTAAAGAGCCTTCACGTGATTGGGATCAAGAAAGAAGGTCTTACTTAAATCGTTTGTACGATGGAAGAGAGGTAGATTGTATTGAACAATTACGAGTCAGCAAGAGCGCATTTAGGAAGTTATGTGAGATTTTACATGGAATAGGTGGGCTGGTTCGTACAAGAAATGTTCCTATTGAAGAATCAGTAGCTATGTTTCTGGACATACTTGGAAACAACGTGAAGTACAGAAAAATTGGTTTTATATATTATCGTTCTAAGGAAACAGTTAGTCGGCAATTCCATAATGTGTTATATGCAATGATGAGAATAAGCAAGGAATACTTGAAATTATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DDE_Tnp_4

Protein Analysis

162

Amino Acids

19.24

Weight (kDa)

9.77

Isoelectric Point (pI)

62.13

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF8040 PF26138 63 - 153 8e-24 Domain of unknown function (DUF8040)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000468)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g04030 FvH4_2g09411 FvH4_3g15551 FvH4_3g36421 FvH4_4g11701 FvH4_5g36381 FvH4_6g09143 FvH4_6g09144 FvH4_6g21972
malus_domestica MD00G1096500.v1.1 MD00G1122500.v1.1 MD02G1090600.v1.1 MD02G1173300.v1.1 MD05G1202800.v1.1 MD14G1123600.v1.1
prunus_persica Prupe.1G083600_v2.0.a1 Prupe.1G245300_v2.0.a1 Prupe.5G002100_v2.0.a1 Prupe.6G061200_v2.0.a1
pyrus_communis pycom01g07060 pycom02g13920 pycom04g11780 pycom04g13480 pycom04g21940 pycom06g07950 pycom07g03740 pycom07g03980 pycom09g02010 pycom09g02020 pycom09g11510 pycom09g14260 pycom10g02500 pycom10g15690 pycom12g08730 pycom12g08740 pycom14g19840 pycom15g16780 pycom15g24940 pycom15g25660 pycom16g21630 pycom16g26320
rosa_chinensis RchiOBHm_Chr1g0330371 RchiOBHm_Chr1g0331991 RchiOBHm_Chr6g0300321
rosa_laevigata RLG00000013795
rosa_multiflora Rmu_sc0000060.1_g000010 Rmu_sc0000288.1_g000044 Rmu_sc0002219.1_g000002 Rmu_sc0003995.1_g000003
rosa_roxburghii Rroxscaffold_1G00059020 Rroxscaffold_2G00108450 Rroxscaffold_2G00112460 Rroxscaffold_5G00375700 Rroxscaffold_5G00381640 Rroxscaffold_7G00158590
rosa_rugosa Rorug01G0237300 Rorug01G0237400 Rorug01G0237500 Rorug02G0051900 Rorug03G0260600 Rorug03G0285800 Rorug04G0076800 Rorug04G0162600 Rorug07G0264500 Rorug07G0264500
rosa_samantha Rh2DG003500 Rh3CG244800 Rh4CG334200 Rh5AG318300 Rh5BG549000 Rh7AG126400 Rh7CG118500 Rh7CG154500 Rh7DG025400
rosa_wichuraiana Rw1G026390 Rw2G005400 Rw2G034490 Rw3G019530 Rw3G028000 Rw4G010490 Rw5G010830 Rw5G023340 Rw5G026580 Rw5G041150 Rw6G003010 Rw6G003290 Rw6G010630 Rw6G021220 Rw6G035650 Rw7G014310

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 29
AclWI GGATC 1 cut(s) 186
AcvI CACGTG 1 cut(s) 170
AfaI GTAC 3 cut(s) 212, 313, 380
AgsI TTSAA 3 cut(s) 239, 332, 481
AluBI AGCT 1 cut(s) 344
AluI AGCT 1 cut(s) 344
AlwI GGATC 1 cut(s) 186
AspLEI GCGC 1 cut(s) 263
AsuHPI GGTGA 1 cut(s) 32
BbrPI CACGTG 1 cut(s) 170
BccI CCATC 1 cut(s) 209
BsaAI YACGTR 1 cut(s) 170
BsaBI GATNNNNATC 1 cut(s) 177
Bse3DI GCAATG 1 cut(s) 459
Bse8I GATNNNNATC 1 cut(s) 177
BseJI GATNNNNATC 1 cut(s) 177
BseMI GCAATG 1 cut(s) 459
Bsp143I GATC 1 cut(s) 178
BspPI GGATC 1 cut(s) 186
BsrDI GCAATG 1 cut(s) 459
BssMI GATC 1 cut(s) 178
Bst4CI ACNGT 2 cut(s) 106, 421
Bst6I CTCTTC 2 cut(s) 57, 214
BstBAI YACGTR 1 cut(s) 170
BstC8I GCNNGC 1 cut(s) 51
BstDEI CTNAG 1 cut(s) 411
BstHHI GCGC 1 cut(s) 263
BstKTI GATC 1 cut(s) 181
BstMBI GATC 1 cut(s) 178
Cac8I GCNNGC 1 cut(s) 51
CfoI GCGC 1 cut(s) 263
Csp6I GTAC 3 cut(s) 211, 312, 379
CviAII CATG 1 cut(s) 290
CviJI RGCY 4 cut(s) 5, 163, 304, 344
CviKI_1 RGCY 4 cut(s) 5, 163, 304, 344
CviQI GTAC 3 cut(s) 211, 312, 379
DdeI CTNAG 1 cut(s) 411
DpnI GATC 1 cut(s) 180
DpnII GATC 1 cut(s) 178
Eam1104I CTCTTC 2 cut(s) 57, 214
EarI CTCTTC 2 cut(s) 57, 214
Eco72I CACGTG 1 cut(s) 170
FaeI CATG 1 cut(s) 293
FalI AAGNNNNNCTT 3 cut(s) 178, 210, 461
FatI CATG 1 cut(s) 289
GlaI GCGC 1 cut(s) 262
HhaI GCGC 1 cut(s) 263
Hin1II CATG 1 cut(s) 293
Hin6I GCGC 1 cut(s) 261
HinP1I GCGC 1 cut(s) 261
HinfI GANTC 2 cut(s) 249, 335
HphI GGTGA 1 cut(s) 32
Hpy188III TCNNGA 2 cut(s) 182, 353
HpyAV CCTTC 2 cut(s) 174, 183
HpyCH4III ACNGT 2 cut(s) 106, 421
HpyCH4IV ACGT 2 cut(s) 169, 372
HpyCH4V TGCA 1 cut(s) 452
HpyF3I CTNAG 1 cut(s) 411
HpySE526I ACGT 2 cut(s) 169, 372
Hsp92II CATG 1 cut(s) 293
HspAI GCGC 1 cut(s) 261
Kzo9I GATC 1 cut(s) 178
LpnPI CCDG 2 cut(s) 290, 338
MaeII ACGT 2 cut(s) 169, 372
MalI GATC 1 cut(s) 180
MboI GATC 1 cut(s) 178
MboII GAAGA 4 cut(s) 71, 74, 231, 344
MluCI AATT 5 cut(s) 87, 242, 387, 431, 482
MlyI GAGTC 1 cut(s) 258
MnlI CCTC 3 cut(s) 27, 58, 217
MseI TTAA 4 cut(s) 38, 122, 156, 200
NdeII GATC 1 cut(s) 178
NlaIII CATG 1 cut(s) 293
PfeI GAWTC 1 cut(s) 335
PleI GAGTC 1 cut(s) 257
PmaCI CACGTG 1 cut(s) 170
PmlI CACGTG 1 cut(s) 170
PpsI GAGTC 1 cut(s) 257
Ppu21I YACGTR 1 cut(s) 170
PsiI TTATAA 1 cut(s) 29
PspCI CACGTG 1 cut(s) 170
RsaI GTAC 3 cut(s) 212, 313, 380
RsaNI GTAC 3 cut(s) 211, 312, 379
SaqAI TTAA 4 cut(s) 38, 122, 156, 200
Sau3AI GATC 1 cut(s) 178
SchI GAGTC 1 cut(s) 258
SetI ASST 7 cut(s) 38, 172, 194, 228, 301, 346, 375
Sse9I AATT 5 cut(s) 87, 242, 387, 431, 482
TaaI ACNGT 2 cut(s) 106, 421
TaiI ACGT 2 cut(s) 172, 375
TasI AATT 5 cut(s) 87, 242, 387, 431, 482
TatI WGTACW 1 cut(s) 378
TfiI GAWTC 1 cut(s) 335
Tru1I TTAA 4 cut(s) 38, 122, 156, 200
Tru9I TTAA 4 cut(s) 38, 122, 156, 200
TspDTI ATGAA 1 cut(s) 98
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.