Rmu_sc0003995.1_g000003
MYB Family

nuclease HARBI1

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003995.1
OG0000468
Physical Location & Seq
Reverse (-)
6684 .. 7462
779 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003995.1_g000003.1.cds

Sequence Viewer

Length: 600 bp
atgcagttcatatttgtcttaccgggttgggagggatctgcattggactctagagttcttcacgatgcatcggactctagagttctgcacgatgcagtgaataggccgaatggattaagagttcccactggttattattaccttgtagatggtggttacacaaatggtgagggatttcttgcaccatatagaggaacaaggtatcatttgtcggaatgggatgaaagaaatatgcctactgatcatgtggaatattttaacatgaagcattccaaggcaagaaatgtgatagaacggtgttttggaatgctaaaaggaaggagagagatgtccattgatccgatggagtatgcagtatgtgaattagatgcacaaaatggggaagaagctgatgtagttggcacggttgaagcatctaatcaatggactacttggaggaatgaattagctttacaaatgcataatgaatggacgggaagaagggctgtaagggctgccggagatacaggggtttcaggtgctgctgcaagggctgcaaggaatgcaagagctgcaggggatggaagagctgcaagggctgctccagcttcaagagaataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DDE_Tnp_4 Myb_DNA-bind_3

Protein Analysis

199

Amino Acids

22.17

Weight (kDa)

6.09

Isoelectric Point (pI)

31.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000468)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g04030 FvH4_2g09411 FvH4_3g15551 FvH4_3g36421 FvH4_4g11701 FvH4_5g36381 FvH4_6g09143 FvH4_6g09144 FvH4_6g21972
malus_domestica MD00G1096500.v1.1 MD00G1122500.v1.1 MD02G1090600.v1.1 MD02G1173300.v1.1 MD05G1202800.v1.1 MD14G1123600.v1.1
prunus_persica Prupe.1G083600_v2.0.a1 Prupe.1G245300_v2.0.a1 Prupe.5G002100_v2.0.a1 Prupe.6G061200_v2.0.a1
pyrus_communis pycom01g07060 pycom02g13920 pycom04g11780 pycom04g13480 pycom04g21940 pycom06g07950 pycom07g03740 pycom07g03980 pycom09g02010 pycom09g02020 pycom09g11510 pycom09g14260 pycom10g02500 pycom10g15690 pycom12g08730 pycom12g08740 pycom14g19840 pycom15g16780 pycom15g24940 pycom15g25660 pycom16g21630 pycom16g26320
rosa_chinensis RchiOBHm_Chr1g0330371 RchiOBHm_Chr1g0331991 RchiOBHm_Chr6g0300321
rosa_laevigata RLG00000013795
rosa_multiflora Rmu_sc0000060.1_g000010 Rmu_sc0000288.1_g000044 Rmu_sc0002219.1_g000002 Rmu_sc0003995.1_g000003
rosa_roxburghii Rroxscaffold_1G00059020 Rroxscaffold_2G00108450 Rroxscaffold_2G00112460 Rroxscaffold_5G00375700 Rroxscaffold_5G00381640 Rroxscaffold_7G00158590
rosa_rugosa Rorug01G0237300 Rorug01G0237400 Rorug01G0237500 Rorug02G0051900 Rorug03G0260600 Rorug03G0285800 Rorug04G0076800 Rorug04G0162600 Rorug07G0264500 Rorug07G0264500
rosa_samantha Rh2DG003500 Rh3CG244800 Rh4CG334200 Rh5AG318300 Rh5BG549000 Rh7AG126400 Rh7CG118500 Rh7CG154500 Rh7DG025400
rosa_wichuraiana Rw1G026390 Rw2G005400 Rw2G034490 Rw3G019530 Rw3G028000 Rw4G010490 Rw5G010830 Rw5G023340 Rw5G026580 Rw5G041150 Rw6G003010 Rw6G003290 Rw6G010630 Rw6G021220 Rw6G035650 Rw7G014310

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 43, 332
AfiI CCNNNNNNNGG 1 cut(s) 191
AgsI TTSAA 2 cut(s) 410, 591
AjuI GAANNNNNNNTTGG 2 cut(s) 285, 317
AloI GAACNNNNNNTCC 2 cut(s) 105, 137
AluBI AGCT 5 cut(s) 389, 449, 551, 569, 587
AluI AGCT 5 cut(s) 389, 449, 551, 569, 587
AlwI GGATC 2 cut(s) 43, 332
AlwNI CAGNNNCTG 1 cut(s) 521
AoxI GGCC 1 cut(s) 104
ApeKI GCWGC 7 cut(s) 494, 521, 524, 533, 551, 569, 578
AsuC2I CCSGG 1 cut(s) 24
AsuHPI GGTGA 1 cut(s) 179
BaeI ACNNNNGTAYC 2 cut(s) 495, 528
BbvI GCAGC 7 cut(s) 481, 508, 511, 520, 538, 556, 565
BccI CCATC 3 cut(s) 143, 337, 554
BclI TGATCA 1 cut(s) 241
BcnI CCSGG 1 cut(s) 24
BfaI CTAG 2 cut(s) 51, 78
BfmI CTRYAG 1 cut(s) 552
BisI GCNGC 7 cut(s) 495, 522, 525, 534, 552, 570, 579
BlsI GCNGC 7 cut(s) 496, 523, 526, 535, 553, 571, 580
Bme1390I CCNGG 1 cut(s) 24
BmrFI CCNGG 1 cut(s) 24
BmsI GCATC 5 cut(s) 55, 77, 82, 358, 422
BpmI CTGGAG 1 cut(s) 567
BpuMI CCSGG 1 cut(s) 24
BsaJI CCNNGG 1 cut(s) 273
Bsc4I CCNNNNNNNGG 1 cut(s) 191
Bse1I ACTGG 1 cut(s) 133
BseDI CCNNGG 1 cut(s) 273
BseGI GGATG 2 cut(s) 226, 565
BseLI CCNNNNNNNGG 1 cut(s) 191
BseNI ACTGG 1 cut(s) 133
BseXI GCAGC 7 cut(s) 481, 508, 511, 520, 538, 556, 565
BsgI GTGCAG 1 cut(s) 71
BshFI GGCC 1 cut(s) 106
BsiSI CCGG 2 cut(s) 23, 498
BslI CCNNNNNNNGG 1 cut(s) 191
BsmI GAATGC 3 cut(s) 268, 312, 547
BsnI GGCC 1 cut(s) 106
Bsp143I GATC 3 cut(s) 35, 241, 337
BspANI GGCC 1 cut(s) 106
BspMAI CTGCAG 1 cut(s) 556
BspPI GGATC 2 cut(s) 43, 332
BspQI GCTCTTC 1 cut(s) 559
BsrI ACTGG 1 cut(s) 133
BssECI CCNNGG 1 cut(s) 273
BssMI GATC 3 cut(s) 35, 241, 337
BssT1I CCWWGG 1 cut(s) 273
Bst4CI ACNGT 2 cut(s) 297, 406
Bst6I CTCTTC 1 cut(s) 559
BstAPI GCANNNNNTGC 4 cut(s) 533, 542, 551, 578
BstF5I GGATG 2 cut(s) 226, 565
BstKTI GATC 3 cut(s) 38, 244, 340
BstMBI GATC 3 cut(s) 35, 241, 337
BstMWI GCNNNNNNNGC 8 cut(s) 491, 530, 533, 542, 551, 575, 578, 584
BstSCI CCNGG 1 cut(s) 22
BstSFI CTRYAG 1 cut(s) 552
BstV1I GCAGC 7 cut(s) 481, 508, 511, 520, 538, 556, 565
BstX2I RGATCY 1 cut(s) 35
BstYI RGATCY 1 cut(s) 35
BsuRI GGCC 1 cut(s) 106
BtsCI GGATG 2 cut(s) 226, 565
BtsI GCAGTG 1 cut(s) 102
BtsIMutI CAGTG 2 cut(s) 102, 126
CaiI CAGNNNCTG 1 cut(s) 521
CviAII CATG 2 cut(s) 245, 262
DpnI GATC 3 cut(s) 37, 243, 339
DpnII GATC 3 cut(s) 35, 241, 337
Eam1104I CTCTTC 1 cut(s) 559
EarI CTCTTC 1 cut(s) 559
Eco130I CCWWGG 1 cut(s) 273
EcoT14I CCWWGG 1 cut(s) 273
EcoT22I ATGCAT 2 cut(s) 70, 462
ErhI CCWWGG 1 cut(s) 273
FaeI CATG 2 cut(s) 248, 265
FaiI YATR 9 cut(s) 11, 187, 189, 233, 246, 263, 351, 358, 462
FatI CATG 2 cut(s) 244, 261
FbaI TGATCA 1 cut(s) 241
Fnu4HI GCNGC 7 cut(s) 495, 522, 525, 534, 552, 570, 579
FokI GGATG 2 cut(s) 233, 572
Fsp4HI GCNGC 7 cut(s) 495, 522, 525, 534, 552, 570, 579
FspBI CTAG 2 cut(s) 51, 78
GluI GCNGC 7 cut(s) 495, 522, 525, 534, 552, 570, 579
GsuI CTGGAG 1 cut(s) 567
HaeIII GGCC 1 cut(s) 106
HapII CCGG 2 cut(s) 23, 498
Hin1II CATG 2 cut(s) 248, 265
HinfI GANTC 2 cut(s) 47, 74
HpaII CCGG 2 cut(s) 23, 498
HphI GGTGA 1 cut(s) 179
Hpy188I TCNGA 3 cut(s) 73, 214, 342
Hpy188III TCNNGA 4 cut(s) 51, 62, 78, 591
HpyAV CCTTC 2 cut(s) 312, 474
HpyCH4III ACNGT 2 cut(s) 297, 406
HpyF10VI GCNNNNNNNGC 8 cut(s) 491, 530, 533, 542, 551, 575, 578, 584
Hsp92II CATG 2 cut(s) 248, 265
Ksp22I TGATCA 1 cut(s) 241
Kzo9I GATC 3 cut(s) 35, 241, 337
LguI GCTCTTC 1 cut(s) 559
LmnI GCTCC 1 cut(s) 586
LpnPI CCDG 6 cut(s) 36, 114, 492, 501, 511, 540
Lsp1109I GCAGC 7 cut(s) 481, 508, 511, 520, 538, 556, 565
LweI GCATC 5 cut(s) 55, 77, 82, 358, 422
MaeI CTAG 2 cut(s) 51, 78
MaeIII GTNAC 1 cut(s) 155
MalI GATC 3 cut(s) 37, 243, 339
MboI GATC 3 cut(s) 35, 241, 337
MboII GAAGA 4 cut(s) 50, 395, 489, 576
MflI RGATCY 1 cut(s) 35
MluCI AATT 2 cut(s) 362, 443
MlyI GAGTC 2 cut(s) 41, 68
MmeI TCCRAC 1 cut(s) 192
MnlI CCTC 4 cut(s) 25, 163, 185, 429
Mph1103I ATGCAT 2 cut(s) 70, 462
MseI TTAA 2 cut(s) 116, 258
MspI CCGG 2 cut(s) 23, 498
MspR9I CCNGG 1 cut(s) 24
Mva1269I GAATGC 3 cut(s) 268, 312, 547
MwoI GCNNNNNNNGC 8 cut(s) 491, 530, 533, 542, 551, 575, 578, 584
NciI CCSGG 1 cut(s) 24
NdeII GATC 3 cut(s) 35, 241, 337
NlaIII CATG 2 cut(s) 248, 265
NsiI ATGCAT 2 cut(s) 70, 462
PciSI GCTCTTC 1 cut(s) 559
PctI GAATGC 3 cut(s) 268, 312, 547
PkrI GCNGC 7 cut(s) 496, 523, 526, 535, 553, 571, 580
PleI GAGTC 2 cut(s) 41, 68
PpsI GAGTC 2 cut(s) 41, 68
PstI CTGCAG 1 cut(s) 556
PstNI CAGNNNCTG 1 cut(s) 521
PsuI RGATCY 1 cut(s) 35
SapI GCTCTTC 1 cut(s) 559
SaqAI TTAA 2 cut(s) 116, 258
SatI GCNGC 7 cut(s) 495, 522, 525, 534, 552, 570, 579
Sau3AI GATC 3 cut(s) 35, 241, 337
SchI GAGTC 2 cut(s) 41, 68
ScrFI CCNGG 1 cut(s) 24
SetI ASST 8 cut(s) 144, 203, 391, 451, 520, 553, 571, 589
SfaNI GCATC 5 cut(s) 55, 77, 82, 358, 422
SfcI CTRYAG 1 cut(s) 552
Sse9I AATT 2 cut(s) 362, 443
SspI AATATT 1 cut(s) 254
SspMI CTAG 2 cut(s) 51, 78
StyD4I CCNGG 1 cut(s) 22
StyI CCWWGG 1 cut(s) 273
TaaI ACNGT 2 cut(s) 297, 406
TasI AATT 2 cut(s) 362, 443
Tru1I TTAA 2 cut(s) 116, 258
Tru9I TTAA 2 cut(s) 116, 258
TscAI CASTG 2 cut(s) 102, 133
TseI GCWGC 7 cut(s) 494, 521, 524, 533, 551, 569, 578
TspDTI ATGAA 4 cut(s) 237, 278, 456, 480
TspRI CASTG 2 cut(s) 102, 133
XbaI TCTAGA 2 cut(s) 50, 77
XcmI CCANNNNNNNNNTGG 1 cut(s) 340
XspI CTAG 2 cut(s) 51, 78
Zsp2I ATGCAT 2 cut(s) 70, 462
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.