pycom04g11780

Ribonuclease H protein

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr4
Physical Location & Seq
Reverse (-)
14701232 .. 14701711
480 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom04g11780.1

Sequence Viewer

Length: 480 bp
ATGGATGAATATGAGACTCAATTCTTTGTTCTTTTGAACGTTTGGATTATAATGGCACAAGTCTTTACTATGAATGCAAAATTGTTGAGGTATAGACAACAACAAAGGAGACAACGGGAAAGAGCTAGTTTAGAGCAGAGGACATTTGTTAGACTTCATGTTAGGAGAGAGGAAATAAATCGTATCACGCGATTGAGTGATACTAACTGTTTGTGGGAGCTACGAATGGATAGGAATGCATTTGCAGTTTTATGTGATTTACTACAAATTCGTGATGGGTTGGTAGATGATAGTCATGTTACAATAGAGGAGCAAGTAGCTACTTTTGTTACCATATTAGCCCACCACAATAAAAACAGGTCAATGCAAGTTAGATTCTTTAGGTCTGGTGAAACTATTAGTCGGTATATCCGCAGAGTATTGTGTGCGTTGCTCAATTTGCAAGACTTGTTGTTTGCAAAACCAACCCCTATCCCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

160

Amino Acids

19.08

Weight (kDa)

9.79

Isoelectric Point (pI)

50.89

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF8040 PF26138 59 - 145 1.8e-23 Domain of unknown function (DUF8040)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000468)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g04030 FvH4_2g09411 FvH4_3g15551 FvH4_3g36421 FvH4_4g11701 FvH4_5g36381 FvH4_6g09143 FvH4_6g09144 FvH4_6g21972
malus_domestica MD00G1096500.v1.1 MD00G1122500.v1.1 MD02G1090600.v1.1 MD02G1173300.v1.1 MD05G1202800.v1.1 MD14G1123600.v1.1
prunus_persica Prupe.1G083600_v2.0.a1 Prupe.1G245300_v2.0.a1 Prupe.5G002100_v2.0.a1 Prupe.6G061200_v2.0.a1
pyrus_communis pycom01g07060 pycom02g13920 pycom04g11780 pycom04g13480 pycom04g21940 pycom06g07950 pycom07g03740 pycom07g03980 pycom09g02010 pycom09g02020 pycom09g11510 pycom09g14260 pycom10g02500 pycom10g15690 pycom12g08730 pycom12g08740 pycom14g19840 pycom15g16780 pycom15g24940 pycom15g25660 pycom16g21630 pycom16g26320
rosa_chinensis RchiOBHm_Chr1g0330371 RchiOBHm_Chr1g0331991 RchiOBHm_Chr6g0300321
rosa_laevigata RLG00000013795
rosa_multiflora Rmu_sc0000060.1_g000010 Rmu_sc0000288.1_g000044 Rmu_sc0002219.1_g000002 Rmu_sc0003995.1_g000003
rosa_roxburghii Rroxscaffold_1G00059020 Rroxscaffold_2G00108450 Rroxscaffold_2G00112460 Rroxscaffold_5G00375700 Rroxscaffold_5G00381640 Rroxscaffold_7G00158590
rosa_rugosa Rorug01G0237300 Rorug01G0237400 Rorug01G0237500 Rorug02G0051900 Rorug03G0260600 Rorug03G0285800 Rorug04G0076800 Rorug04G0162600 Rorug07G0264500 Rorug07G0264500
rosa_samantha Rh2DG003500 Rh3CG244800 Rh4CG334200 Rh5AG318300 Rh5BG549000 Rh7AG126400 Rh7CG118500 Rh7CG154500 Rh7DG025400
rosa_wichuraiana Rw1G026390 Rw2G005400 Rw2G034490 Rw3G019530 Rw3G028000 Rw4G010490 Rw5G010830 Rw5G023340 Rw5G026580 Rw5G041150 Rw6G003010 Rw6G003290 Rw6G010630 Rw6G021220 Rw6G035650 Rw7G014310

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 50
AccII CGCG 1 cut(s) 190
AciI CCGC 1 cut(s) 412
AclI AACGTT 1 cut(s) 39
AcsI RAATTY 1 cut(s) 267
AgsI TTSAA 1 cut(s) 37
AluBI AGCT 3 cut(s) 125, 220, 320
AluI AGCT 3 cut(s) 125, 220, 320
Alw26I GTCTC 2 cut(s) 8, 103
ApoI RAATTY 1 cut(s) 267
ArsI GACNNNNNNTTYG 2 cut(s) 437, 469
AsuHPI GGTGA 1 cut(s) 401
BccI CCATC 1 cut(s) 269
BcoDI GTCTC 2 cut(s) 8, 103
BfaI CTAG 1 cut(s) 126
BseGI GGATG 1 cut(s) 10
BseRI GAGGAG 1 cut(s) 323
Bsh1236I CGCG 1 cut(s) 190
BsmAI GTCTC 2 cut(s) 8, 103
BsmI GAATGC 2 cut(s) 79, 241
BspACI CCGC 1 cut(s) 412
BspFNI CGCG 1 cut(s) 190
Bst4CI ACNGT 1 cut(s) 209
BstF5I GGATG 1 cut(s) 10
BstFNI CGCG 1 cut(s) 190
BstMAI GTCTC 2 cut(s) 8, 103
BstMWI GCNNNNNNNGC 1 cut(s) 439
BstUI CGCG 1 cut(s) 190
BtsCI GGATG 1 cut(s) 10
CviAII CATG 2 cut(s) 158, 296
CviJI RGCY 4 cut(s) 125, 220, 320, 341
CviKI_1 RGCY 4 cut(s) 125, 220, 320, 341
EcoT22I ATGCAT 1 cut(s) 241
FaeI CATG 2 cut(s) 161, 299
FatI CATG 2 cut(s) 157, 295
FokI GGATG 1 cut(s) 17
FspBI CTAG 1 cut(s) 126
Hin1II CATG 2 cut(s) 161, 299
HinfI GANTC 2 cut(s) 16, 375
HphI GGTGA 1 cut(s) 401
Hpy188III TCNNGA 1 cut(s) 272
HpyCH4III ACNGT 1 cut(s) 209
HpyCH4IV ACGT 1 cut(s) 39
HpyCH4V TGCA 6 cut(s) 77, 239, 245, 367, 442, 458
HpyF10VI GCNNNNNNNGC 1 cut(s) 439
HpySE526I ACGT 1 cut(s) 39
Hsp92II CATG 2 cut(s) 161, 299
LmnI GCTCC 2 cut(s) 217, 310
LpnPI CCDG 2 cut(s) 343, 372
MaeI CTAG 1 cut(s) 126
MaeII ACGT 1 cut(s) 39
MaeIII GTNAC 2 cut(s) 298, 328
MluCI AATT 4 cut(s) 20, 80, 267, 436
MlyI GAGTC 1 cut(s) 10
MnlI CCTC 4 cut(s) 81, 132, 163, 301
Mph1103I ATGCAT 1 cut(s) 241
Mva1269I GAATGC 2 cut(s) 79, 241
MvnI CGCG 1 cut(s) 190
MwoI GCNNNNNNNGC 1 cut(s) 439
NlaIII CATG 2 cut(s) 161, 299
NsiI ATGCAT 1 cut(s) 241
PcsI WCGNNNNNNNCGW 1 cut(s) 187
PctI GAATGC 2 cut(s) 79, 241
PfeI GAWTC 1 cut(s) 375
PleI GAGTC 1 cut(s) 10
PpsI GAGTC 1 cut(s) 10
PsiI TTATAA 1 cut(s) 50
Psp1406I AACGTT 1 cut(s) 39
SchI GAGTC 1 cut(s) 10
SetI ASST 7 cut(s) 42, 92, 127, 222, 322, 362, 386
Sse9I AATT 4 cut(s) 20, 80, 267, 436
SsiI CCGC 1 cut(s) 412
SspMI CTAG 1 cut(s) 126
TaaI ACNGT 1 cut(s) 209
TaiI ACGT 1 cut(s) 42
TasI AATT 4 cut(s) 20, 80, 267, 436
TfiI GAWTC 1 cut(s) 375
TspDTI ATGAA 3 cut(s) 21, 86, 146
XapI RAATTY 1 cut(s) 267
XspI CTAG 1 cut(s) 126
Zsp2I ATGCAT 1 cut(s) 241
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.