MD07G1161000.v1.1
ERF Family

Belongs to the class I-like SAM-binding methyltransferase superfamily. Cation-independent O- methyltransferase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr07
OG0000357
Physical Location & Seq
Reverse (-)
23575773 .. 23579726
3954 bp
Loading structure...
UTR
Exon/CDS
Intron
MD07G1161000.v1.1.491

Sequence Viewer

Length: 765 bp
ATGCAGTCGGCAATTGAGCTTGGCGTTTTTGACATCATAGCGAAAGAGGGTCCAAATGCCAAGCTCTCTGCATCTGAGATTGCAACTCACATCGGCACCATGACCCCTGACGGACCCATGATGCTAGATCGTCTTCTAGCTGTCCTGGCCAGTAACTCCGTCCTCGATTGCACGGTTGTTAAAGGTAAAGTTGAAAAGTGTTTCCGAAGGCTCTACAGCCTTACCCCTGTGTCCAAGCAATTTGTGACTACTGAAGATGGTGTTTCCTTAGGCCCTGTATTGGCGCTGTTTCAAGACAAGTACGCAGGTGTCGACCCTAGGTTTAATAAAATGTTCAACAAGGGAATGTTCAACTGGACCACCATACTTATGAAGAGGATTCTTGATCTCTACAAAGGGTTTGAGCACGTTAAGCAGATTGTTGATGTTGGTGGTAGTCTGGGAGTAGCAATTAGTCTAATCACTTCTAAATATCCACATATTAAAGGCATCAATTTTGACTTGCCTCATGTTAGAAAACATGCCCCCTCTTATCCTGACGATGGAAAAGTGATTGTGGTGGAGGCCCTTCTCCCAATTAAGCCGGAGACTGACCTATCTGTGAGGGTAAACGCCCTATTTGATGTGCATATGATGACTCAAACACGGGGAGGGATGGAGAGGAGCCCAGAAGAATTCACGGCCCTGGCAACTGGTGCTGGATTTAGTGGCATCAGATTTGAATGTTTTGCCGCTAATTTTGGGGTGATGGAATTCTACAAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00940 ko01058 ko01100 ko01110 map00940 map01058 map01100 map01110
Pfam Domains
Protein Families
Dimerisation Methyltransf_2

Protein Analysis

255

Amino Acids

27.97

Weight (kDa)

7.72

Isoelectric Point (pI)

35.66

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Dimerisation PF08100 1 - 83 4.3e-16 O-methyltransferase dimerisation domain
Methyltransf_2 PF00891 101 - 178 1.9e-18 O-methyltransferase domain
Methyltransf_2 PF00891 179 - 236 1.3e-09 O-methyltransferase domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000357)

Species Orthologous Gene IDs
fragaria_vesca FvH4_7g17810 FvH4_7g17811 FvH4_7g17820 FvH4_7g17830
malus_domestica MD00G1100700.v1.1 MD01G1089600.v1.1 MD01G1089800.v1.1 MD01G1090400.v1.1 MD01G1090500.v1.1 MD01G1090800.v1.1 MD04G1141100.v1.1 MD07G1161000.v1.1 MD07G1161100.v1.1 MD10G1030000.v1.1 MD10G1030200.v1.1 MD15G1409200.v1.1 MD15G1409700.v1.1
prunus_persica Prupe.2G199100_v2.0.a1 Prupe.2G199100_v2.0.a1 Prupe.2G199300_v2.0.a1 Prupe.2G199400_v2.0.a1 Prupe.2G199400_v2.0.a1 Prupe.2G199500_v2.0.a1 Prupe.2G199600_v2.0.a1 Prupe.2G199600_v2.0.a1 Prupe.2G199800_v2.0.a1 Prupe.2G200100_v2.0.a1 Prupe.2G200100_v2.0.a1
pyrus_communis pycom01g11360 pycom01g11370 pycom01g11400 pycom01g11440 pycom01g11480 pycom01g11490 pycom07g15690 pycom08g12100
rosa_chinensis RchiOBHm_Chr1g0317931 RchiOBHm_Chr1g0361211 RchiOBHm_Chr1g0361221 RchiOBHm_Chr1g0361241 RchiOBHm_Chr1g0367691 RchiOBHm_Chr4g0390171 RchiOBHm_Chr4g0396271 RchiOBHm_Chr6g0286421
rosa_laevigata RLG00000002555 RLG00000009555 RLG00000027275 RLG00000027731 RLG00000027732 RLG00000027734 RLG00000027738 RLG00000030575
rosa_multiflora Rmu_co8470451.1_g000001 Rmu_sc0000250.1_g000010 Rmu_sc0010379.1_g000006 Rmu_sc0011132.1_g000005 Rmu_sc0011132.1_g000007 Rmu_sc0038028.1_g000001 Rmu_ssc0000008.1_g000043 Rmu_ssc0000234.1_g000002 Rmu_ssc0000418.1_g000001
rosa_roxburghii Rroxscaffold_2G00116370 Rroxscaffold_4G00289300 Rroxscaffold_4G00295130 Rroxscaffold_4G00295140 Rroxscaffold_4G00295160 Rroxscaffold_4G00295190 Rroxscaffold_4G00295220 Rroxscaffold_4G00330100 Rroxscaffold_5G00341100
rosa_rugosa Rorug01G0287600 Rorug01G0287700 Rorug01G0336200 Rorug01G0336200 Rorug03G0350700
rosa_samantha Rh1AG030300 Rh1AG298500 Rh1AG298600 Rh1AG298700 Rh1AG298900 Rh1BG262400 Rh1BG262500 Rh1BG262800 Rh1BG304800 Rh1CG029000 Rh1CG279800 Rh1CG279900 Rh1CG280000 Rh1CG280100 Rh1CG280200 Rh1CG320500 Rh1DG041200 Rh1DG292700 Rh1DG292800 Rh1DG337100 Rh3DG107500 Rh4AG128100 Rh4BG024900 Rh4CG072700 Rh4DG063000 Rh6CG295900 Rh6DG287700
rosa_wichuraiana Rw1G002290 Rw1G026410 Rw1G026420 Rw1G026440 Rw4G005440

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 296
Acc36I ACCTGC 1 cut(s) 296
AccB1I GGYRCC 1 cut(s) 95
AccI GTMKAC 1 cut(s) 312
AciI CCGC 1 cut(s) 732
AcoI YGGCCR 1 cut(s) 147
AcsI RAATTY 2 cut(s) 674, 752
AcuI CTGAAG 1 cut(s) 273
AfaI GTAC 1 cut(s) 302
AfiI CCNNNNNNNGG 2 cut(s) 280, 542
AgsI TTSAA 5 cut(s) 194, 293, 337, 352, 722
AjnI CCWGG 2 cut(s) 144, 684
AluBI AGCT 3 cut(s) 19, 64, 140
AluI AGCT 3 cut(s) 19, 64, 140
Alw21I GWGCWC 1 cut(s) 408
Alw26I GTCTC 1 cut(s) 581
AoxI GGCC 4 cut(s) 147, 271, 564, 681
ApoI RAATTY 2 cut(s) 674, 752
AspA2I CCTAGG 1 cut(s) 317
AspLEI GCGC 1 cut(s) 286
AspS9I GGNCC 6 cut(s) 50, 113, 272, 357, 565, 682
AsuHPI GGTGA 1 cut(s) 757
AvaII GGWCC 3 cut(s) 50, 113, 357
AvrII CCTAGG 1 cut(s) 317
AxyI CCTNAGG 1 cut(s) 268
BalI TGGCCA 1 cut(s) 149
BanI GGYRCC 1 cut(s) 95
BanII GRGCYC 1 cut(s) 668
BbsI GAAGAC 1 cut(s) 125
Bbv12I GWGCWC 1 cut(s) 408
BccI CCATC 4 cut(s) 251, 536, 649, 742
BceAI ACGGC 1 cut(s) 696
BciT130I CCWGG 2 cut(s) 146, 686
BcoDI GTCTC 1 cut(s) 581
BfaI CTAG 3 cut(s) 125, 137, 318
BfmI CTRYAG 1 cut(s) 214
BfoI RGCGCY 1 cut(s) 287
BfuAI ACCTGC 1 cut(s) 296
BisI GCNGC 1 cut(s) 732
BlnI CCTAGG 1 cut(s) 317
BlsI GCNGC 1 cut(s) 733
Bme1390I CCNGG 2 cut(s) 146, 686
Bme18I GGWCC 3 cut(s) 50, 113, 357
BmgT120I GGNCC 6 cut(s) 50, 113, 272, 357, 565, 682
BmiI GGNNCC 4 cut(s) 51, 97, 115, 665
BmrFI CCNGG 2 cut(s) 146, 686
BmsI GCATC 4 cut(s) 80, 111, 498, 720
BpiI GAAGAC 1 cut(s) 125
BsaJI CCNNGG 2 cut(s) 317, 684
Bsc4I CCNNNNNNNGG 2 cut(s) 280, 542
Bse1I ACTGG 3 cut(s) 150, 359, 697
Bse21I CCTNAGG 1 cut(s) 268
BseBI CCWGG 2 cut(s) 146, 686
BseDI CCNNGG 2 cut(s) 317, 684
BseGI GGATG 1 cut(s) 660
BseLI CCNNNNNNNGG 2 cut(s) 280, 542
BseMII CTCAG 1 cut(s) 66
BseNI ACTGG 3 cut(s) 150, 359, 697
BseRI GAGGAG 1 cut(s) 676
BshFI GGCC 4 cut(s) 149, 273, 566, 683
BshNI GGYRCC 1 cut(s) 95
BsiHKAI GWGCWC 1 cut(s) 408
BsiSI CCGG 1 cut(s) 584
BslI CCNNNNNNNGG 2 cut(s) 280, 542
BsmAI GTCTC 1 cut(s) 581
BsnI GGCC 4 cut(s) 149, 273, 566, 683
Bsp1286I GDGCHC 2 cut(s) 408, 668
Bsp143I GATC 2 cut(s) 127, 385
BspACI CCGC 1 cut(s) 732
BspANI GGCC 4 cut(s) 149, 273, 566, 683
BspCNI CTCAG 1 cut(s) 67
BspLI GGNNCC 4 cut(s) 51, 97, 115, 665
BspMI ACCTGC 1 cut(s) 296
BspT107I GGYRCC 1 cut(s) 95
BsrI ACTGG 3 cut(s) 150, 359, 697
BssECI CCNNGG 2 cut(s) 317, 684
BssMI GATC 2 cut(s) 127, 385
BssT1I CCWWGG 1 cut(s) 317
Bst2UI CCWGG 2 cut(s) 146, 686
Bst4CI ACNGT 1 cut(s) 175
Bst6I CTCTTC 1 cut(s) 368
BstAPI GCANNNNNTGC 1 cut(s) 695
BstDEI CTNAG 2 cut(s) 75, 268
BstF5I GGATG 1 cut(s) 660
BstH2I RGCGCY 1 cut(s) 287
BstHHI GCGC 1 cut(s) 286
BstKTI GATC 2 cut(s) 130, 388
BstMAI GTCTC 1 cut(s) 581
BstMBI GATC 2 cut(s) 127, 385
BstMWI GCNNNNNNNGC 3 cut(s) 146, 412, 695
BstNI CCWGG 2 cut(s) 146, 686
BstNSI RCATGY 1 cut(s) 524
BstSCI CCNGG 2 cut(s) 144, 684
BstSFI CTRYAG 1 cut(s) 214
BstV2I GAAGAC 1 cut(s) 125
Bsu36I CCTNAGG 1 cut(s) 268
BsuRI GGCC 4 cut(s) 149, 273, 566, 683
BtsCI GGATG 1 cut(s) 660
BveI ACCTGC 1 cut(s) 296
CfoI GCGC 1 cut(s) 286
Cfr13I GGNCC 6 cut(s) 50, 113, 272, 357, 565, 682
Csp6I GTAC 1 cut(s) 301
CviAII CATG 4 cut(s) 100, 118, 509, 521
CviQI GTAC 1 cut(s) 301
DdeI CTNAG 2 cut(s) 75, 268
DpnI GATC 2 cut(s) 129, 387
DpnII GATC 2 cut(s) 127, 385
EaeI YGGCCR 1 cut(s) 147
Eam1104I CTCTTC 1 cut(s) 368
EarI CTCTTC 1 cut(s) 368
Eco130I CCWWGG 1 cut(s) 317
Eco24I GRGCYC 1 cut(s) 668
Eco47I GGWCC 3 cut(s) 50, 113, 357
Eco57I CTGAAG 1 cut(s) 273
Eco81I CCTNAGG 1 cut(s) 268
EcoO109I RGGNCCY 2 cut(s) 272, 565
EcoRI GAATTC 2 cut(s) 674, 752
EcoRII CCWGG 2 cut(s) 144, 684
EcoT14I CCWWGG 1 cut(s) 317
EcoT38I GRGCYC 1 cut(s) 668
ErhI CCWWGG 1 cut(s) 317
FaeI CATG 4 cut(s) 103, 121, 512, 524
FatI CATG 4 cut(s) 99, 117, 508, 520
FauNDI CATATG 1 cut(s) 630
FblI GTMKAC 1 cut(s) 312
Fnu4HI GCNGC 1 cut(s) 732
FokI GGATG 1 cut(s) 667
FriOI GRGCYC 1 cut(s) 668
Fsp4HI GCNGC 1 cut(s) 732
FspBI CTAG 3 cut(s) 125, 137, 318
GlaI GCGC 1 cut(s) 285
GluI GCNGC 1 cut(s) 732
HaeII RGCGCY 1 cut(s) 287
HaeIII GGCC 4 cut(s) 149, 273, 566, 683
HapII CCGG 1 cut(s) 584
HhaI GCGC 1 cut(s) 286
Hin1II CATG 4 cut(s) 103, 121, 512, 524
Hin6I GCGC 1 cut(s) 284
HinP1I GCGC 1 cut(s) 284
HincII GTYRAC 1 cut(s) 313
HindII GTYRAC 1 cut(s) 313
HinfI GANTC 2 cut(s) 379, 637
HpaII CCGG 1 cut(s) 584
HphI GGTGA 1 cut(s) 757
Hpy166II GTNNAC 2 cut(s) 313, 610
Hpy188I TCNGA 3 cut(s) 76, 206, 716
Hpy188III TCNNGA 3 cut(s) 293, 383, 536
Hpy8I GTNNAC 2 cut(s) 313, 610
HpyAV CCTTC 2 cut(s) 201, 578
HpyCH4III ACNGT 1 cut(s) 175
HpyCH4IV ACGT 1 cut(s) 408
HpyCH4V TGCA 5 cut(s) 4, 71, 83, 171, 628
HpyF10VI GCNNNNNNNGC 3 cut(s) 146, 412, 695
HpyF3I CTNAG 2 cut(s) 75, 268
HpySE526I ACGT 1 cut(s) 408
Hsp92II CATG 4 cut(s) 103, 121, 512, 524
HspAI GCGC 1 cut(s) 284
Kzo9I GATC 2 cut(s) 127, 385
LmnI GCTCC 1 cut(s) 663
LweI GCATC 4 cut(s) 80, 111, 498, 720
MaeI CTAG 3 cut(s) 125, 137, 318
MaeII ACGT 1 cut(s) 408
MaeIII GTNAC 2 cut(s) 152, 244
MalI GATC 2 cut(s) 129, 387
MboI GATC 2 cut(s) 127, 385
MboII GAAGA 4 cut(s) 125, 266, 385, 683
MfeI CAATTG 1 cut(s) 12
MhlI GDGCHC 2 cut(s) 408, 668
MlsI TGGCCA 1 cut(s) 149
MluCI AATT 8 cut(s) 12, 239, 450, 493, 576, 674, 736, 752
MluNI TGGCCA 1 cut(s) 149
MlyI GAGTC 1 cut(s) 631
MnlI CCTC 9 cut(s) 40, 173, 369, 516, 538, 556, 597, 644, 654
Mox20I TGGCCA 1 cut(s) 149
MscI TGGCCA 1 cut(s) 149
MseI TTAA 5 cut(s) 180, 324, 411, 483, 579
MslI CAYNNNNRTG 1 cut(s) 368
Msp20I TGGCCA 1 cut(s) 149
MspI CCGG 1 cut(s) 584
MspR9I CCNGG 2 cut(s) 146, 686
MunI CAATTG 1 cut(s) 12
MvaI CCWGG 2 cut(s) 146, 686
MwoI GCNNNNNNNGC 3 cut(s) 146, 412, 695
NdeI CATATG 1 cut(s) 630
NdeII GATC 2 cut(s) 127, 385
NlaIII CATG 4 cut(s) 103, 121, 512, 524
NlaIV GGNNCC 4 cut(s) 51, 97, 115, 665
NmuCI GTSAC 1 cut(s) 244
NspI RCATGY 1 cut(s) 524
PaqCI CACCTGC 1 cut(s) 296
PcsI WCGNNNNNNNCGW 1 cut(s) 309
PfeI GAWTC 1 cut(s) 379
PkrI GCNGC 1 cut(s) 733
PleI GAGTC 1 cut(s) 631
PpsI GAGTC 1 cut(s) 631
Psp6I CCWGG 2 cut(s) 144, 684
PspGI CCWGG 2 cut(s) 144, 684
PspN4I GGNNCC 4 cut(s) 51, 97, 115, 665
PspPI GGNCC 6 cut(s) 50, 113, 272, 357, 565, 682
RsaI GTAC 1 cut(s) 302
RsaNI GTAC 1 cut(s) 301
RseI CAYNNNNRTG 1 cut(s) 368
SalI GTCGAC 1 cut(s) 311
SaqAI TTAA 5 cut(s) 180, 324, 411, 483, 579
SatI GCNGC 1 cut(s) 732
Sau3AI GATC 2 cut(s) 127, 385
Sau96I GGNCC 6 cut(s) 50, 113, 272, 357, 565, 682
SchI GAGTC 1 cut(s) 631
ScrFI CCNGG 2 cut(s) 146, 686
SduI GDGCHC 2 cut(s) 408, 668
SetI ASST 8 cut(s) 21, 66, 142, 187, 310, 323, 411, 597
SfaNI GCATC 4 cut(s) 80, 111, 498, 720
SfcI CTRYAG 1 cut(s) 214
SinI GGWCC 3 cut(s) 50, 113, 357
SmiMI CAYNNNNRTG 1 cut(s) 368
Sse9I AATT 8 cut(s) 12, 239, 450, 493, 576, 674, 736, 752
SsiI CCGC 1 cut(s) 732
SspMI CTAG 3 cut(s) 125, 137, 318
StyD4I CCNGG 2 cut(s) 144, 684
StyI CCWWGG 1 cut(s) 317
TaaI ACNGT 1 cut(s) 175
TaiI ACGT 1 cut(s) 411
TaqI TCGA 2 cut(s) 165, 312
TasI AATT 8 cut(s) 12, 239, 450, 493, 576, 674, 736, 752
TauI GCSGC 1 cut(s) 734
TfiI GAWTC 1 cut(s) 379
Tru1I TTAA 5 cut(s) 180, 324, 411, 483, 579
Tru9I TTAA 5 cut(s) 180, 324, 411, 483, 579
TseFI GTSAC 1 cut(s) 244
Tsp45I GTSAC 1 cut(s) 244
TspDTI ATGAA 1 cut(s) 386
TspGWI ACGGA 2 cut(s) 126, 148
VpaK11BI GGWCC 3 cut(s) 50, 113, 357
XapI RAATTY 2 cut(s) 674, 752
XceI RCATGY 1 cut(s) 524
XmaJI CCTAGG 1 cut(s) 317
XmiI GTMKAC 1 cut(s) 312
XspI CTAG 3 cut(s) 125, 137, 318
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.