RLG00000002555
ERF Family

Belongs to the class I-like SAM-binding methyltransferase superfamily. Cation-independent O- methyltransferase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr1
OG0000357
Physical Location & Seq
Reverse (-)
36264549 .. 36265460
912 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000002555

Sequence Viewer

Length: 648 bp
ATGGTCTATGGCAAACACGTCTTTGAGTATGCAGATTCGGACCTCAGGTTTAATCAAGTTTTCAATTCGGGAATGGTTAACCTCACCACTTTGGTTATGAGGAGGATTCTGGATAGCTACCAGGGTTTTAAGCACCTTACCCAGGTTGTTGATCTTGGGGGAGGTCTAGGGGTTGCTCTTAGTCTTATCACTTGCAGATATCCTCATATTAAGGGAATAAACTACGACTTGCCCCATGTCATAAAGCATGCTCCTCATTATTCTGGTGTAGAACATGTAGGAGGTGACATGTTTCCCAAGCGAGGATGCTATTTTTATGAAGGTATGCCAGCATTTTTGAATCTCAAAACATGCATACTTCATGACTGGATGGATGAGCAGTGCATAAAGCTATTGAAAAAGTGTTACACAACGATTCCAGATAATGGAAAAGTAATAGCTGTAGAAGCACTAGTTCCAGTTGAGCTAAACACTAGCCCAGCTGAGAAGATCACCTCAGAGTTTGATGTGCTTATGATGACACTATCCCCAAGAGGGAAGGAAAGGACCCGACACGAATTTATGGACTTGGCAATTGCTGCTGGAATTAGTGGCATAAAATATGCATGTCTTTCTAGTTATCATCACGTTATGGAGTTCATTAAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00940 ko01058 ko01100 ko01110 map00940 map01058 map01100 map01110
Pfam Domains
Protein Families
Dimerisation Methyltransf_2

Protein Analysis

216

Amino Acids

24.29

Weight (kDa)

7.16

Isoelectric Point (pI)

34.81

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Methyltransf_2 PF00891 2 - 196 2.9e-46 O-methyltransferase domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000357)

Species Orthologous Gene IDs
fragaria_vesca FvH4_7g17810 FvH4_7g17811 FvH4_7g17820 FvH4_7g17830
malus_domestica MD00G1100700.v1.1 MD01G1089600.v1.1 MD01G1089800.v1.1 MD01G1090400.v1.1 MD01G1090500.v1.1 MD01G1090800.v1.1 MD04G1141100.v1.1 MD07G1161000.v1.1 MD07G1161100.v1.1 MD10G1030000.v1.1 MD10G1030200.v1.1 MD15G1409200.v1.1 MD15G1409700.v1.1
prunus_persica Prupe.2G199100_v2.0.a1 Prupe.2G199100_v2.0.a1 Prupe.2G199300_v2.0.a1 Prupe.2G199400_v2.0.a1 Prupe.2G199400_v2.0.a1 Prupe.2G199500_v2.0.a1 Prupe.2G199600_v2.0.a1 Prupe.2G199600_v2.0.a1 Prupe.2G199800_v2.0.a1 Prupe.2G200100_v2.0.a1 Prupe.2G200100_v2.0.a1
pyrus_communis pycom01g11360 pycom01g11370 pycom01g11400 pycom01g11440 pycom01g11480 pycom01g11490 pycom07g15690 pycom08g12100
rosa_chinensis RchiOBHm_Chr1g0317931 RchiOBHm_Chr1g0361211 RchiOBHm_Chr1g0361221 RchiOBHm_Chr1g0361241 RchiOBHm_Chr1g0367691 RchiOBHm_Chr4g0390171 RchiOBHm_Chr4g0396271 RchiOBHm_Chr6g0286421
rosa_laevigata RLG00000002555 RLG00000009555 RLG00000027275 RLG00000027731 RLG00000027732 RLG00000027734 RLG00000027738 RLG00000030575
rosa_multiflora Rmu_co8470451.1_g000001 Rmu_sc0000250.1_g000010 Rmu_sc0010379.1_g000006 Rmu_sc0011132.1_g000005 Rmu_sc0011132.1_g000007 Rmu_sc0038028.1_g000001 Rmu_ssc0000008.1_g000043 Rmu_ssc0000234.1_g000002 Rmu_ssc0000418.1_g000001
rosa_roxburghii Rroxscaffold_2G00116370 Rroxscaffold_4G00289300 Rroxscaffold_4G00295130 Rroxscaffold_4G00295140 Rroxscaffold_4G00295160 Rroxscaffold_4G00295190 Rroxscaffold_4G00295220 Rroxscaffold_4G00330100 Rroxscaffold_5G00341100
rosa_rugosa Rorug01G0287600 Rorug01G0287700 Rorug01G0336200 Rorug01G0336200 Rorug03G0350700
rosa_samantha Rh1AG030300 Rh1AG298500 Rh1AG298600 Rh1AG298700 Rh1AG298900 Rh1BG262400 Rh1BG262500 Rh1BG262800 Rh1BG304800 Rh1CG029000 Rh1CG279800 Rh1CG279900 Rh1CG280000 Rh1CG280100 Rh1CG280200 Rh1CG320500 Rh1DG041200 Rh1DG292700 Rh1DG292800 Rh1DG337100 Rh3DG107500 Rh4AG128100 Rh4BG024900 Rh4CG072700 Rh4DG063000 Rh6CG295900 Rh6DG287700
rosa_wichuraiana Rw1G002290 Rw1G026410 Rw1G026420 Rw1G026440 Rw4G005440

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 425
AcsI RAATTY 1 cut(s) 557
AfiI CCNNNNNNNGG 4 cut(s) 142, 302, 425, 534
AflIII ACRYGT 3 cut(s) 16, 274, 288
AgsI TTSAA 3 cut(s) 64, 340, 397
AhlI ACTAGT 1 cut(s) 451
AjiI CACGTC 1 cut(s) 19
AjnI CCWGG 2 cut(s) 120, 141
AluBI AGCT 5 cut(s) 117, 391, 440, 466, 482
AluI AGCT 5 cut(s) 117, 391, 440, 466, 482
ApeKI GCWGC 1 cut(s) 578
ApoI RAATTY 1 cut(s) 557
AspS9I GGNCC 2 cut(s) 40, 546
AsuHPI GGTGA 3 cut(s) 76, 296, 484
AvaII GGWCC 2 cut(s) 40, 546
AxyI CCTNAGG 1 cut(s) 44
BbvI GCAGC 1 cut(s) 565
BccI CCATC 1 cut(s) 364
BciT130I CCWGG 2 cut(s) 122, 143
BcuI ACTAGT 1 cut(s) 451
BfaI CTAG 4 cut(s) 167, 452, 474, 615
BfmI CTRYAG 1 cut(s) 441
BisI GCNGC 1 cut(s) 579
BlsI GCNGC 1 cut(s) 580
Bme1390I CCNGG 2 cut(s) 122, 143
Bme18I GGWCC 2 cut(s) 40, 546
BmgBI CACGTC 1 cut(s) 19
BmgT120I GGNCC 2 cut(s) 40, 546
BmiI GGNNCC 1 cut(s) 548
BmrFI CCNGG 2 cut(s) 122, 143
BmsI GCATC 1 cut(s) 296
BsaJI CCNNGG 2 cut(s) 121, 141
Bsc4I CCNNNNNNNGG 4 cut(s) 142, 302, 425, 534
Bse1I ACTGG 2 cut(s) 371, 458
Bse21I CCTNAGG 1 cut(s) 44
BseBI CCWGG 2 cut(s) 122, 143
BseDI CCNNGG 2 cut(s) 121, 141
BseGI GGATG 3 cut(s) 311, 375, 379
BseLI CCNNNNNNNGG 4 cut(s) 142, 302, 425, 534
BseMII CTCAG 3 cut(s) 58, 474, 510
BseNI ACTGG 2 cut(s) 371, 458
BseRI GAGGAG 2 cut(s) 115, 243
BseXI GCAGC 1 cut(s) 565
BseYI CCCAGC 1 cut(s) 478
BslI CCNNNNNNNGG 4 cut(s) 142, 302, 425, 534
Bsp143I GATC 2 cut(s) 151, 489
BspCNI CTCAG 3 cut(s) 57, 475, 509
BspHI TCATGA 1 cut(s) 361
BspLI GGNNCC 1 cut(s) 548
BsrI ACTGG 2 cut(s) 371, 458
BssECI CCNNGG 2 cut(s) 121, 141
BssMI GATC 2 cut(s) 151, 489
Bst2UI CCWGG 2 cut(s) 122, 143
BstAPI GCANNNNNTGC 1 cut(s) 578
BstC8I GCNNGC 2 cut(s) 249, 330
BstDEI CTNAG 4 cut(s) 44, 179, 483, 496
BstENI CCTNNNNNAGG 1 cut(s) 140
BstF5I GGATG 3 cut(s) 311, 375, 379
BstKTI GATC 2 cut(s) 154, 492
BstMBI GATC 2 cut(s) 151, 489
BstMWI GCNNNNNNNGC 2 cut(s) 446, 578
BstNI CCWGG 2 cut(s) 122, 143
BstNSI RCATGY 5 cut(s) 251, 278, 292, 354, 609
BstSCI CCNGG 2 cut(s) 120, 141
BstSFI CTRYAG 1 cut(s) 441
BstV1I GCAGC 1 cut(s) 565
Bsu36I CCTNAGG 1 cut(s) 44
BtrI CACGTC 1 cut(s) 19
BtsCI GGATG 3 cut(s) 311, 375, 379
BtsI GCAGTG 1 cut(s) 386
BtsIMutI CAGTG 1 cut(s) 386
Cac8I GCNNGC 2 cut(s) 249, 330
CciI TCATGA 1 cut(s) 361
Cfr13I GGNCC 2 cut(s) 40, 546
CviAII CATG 7 cut(s) 236, 248, 275, 289, 351, 362, 606
CviJI RGCY 6 cut(s) 117, 391, 440, 466, 477, 482
CviKI_1 RGCY 6 cut(s) 117, 391, 440, 466, 477, 482
DdeI CTNAG 4 cut(s) 44, 179, 483, 496
DpnI GATC 2 cut(s) 153, 491
DpnII GATC 2 cut(s) 151, 489
Eco32I GATATC 1 cut(s) 200
Eco47I GGWCC 2 cut(s) 40, 546
Eco81I CCTNAGG 1 cut(s) 44
EcoNI CCTNNNNNAGG 1 cut(s) 140
EcoO109I RGGNCCY 1 cut(s) 546
EcoRII CCWGG 2 cut(s) 120, 141
EcoRV GATATC 1 cut(s) 200
EcoT22I ATGCAT 2 cut(s) 356, 607
FaeI CATG 7 cut(s) 239, 251, 278, 292, 354, 365, 609
FatI CATG 7 cut(s) 235, 247, 274, 288, 350, 361, 605
Fnu4HI GCNGC 1 cut(s) 579
FokI GGATG 3 cut(s) 318, 382, 386
Fsp4HI GCNGC 1 cut(s) 579
FspBI CTAG 4 cut(s) 167, 452, 474, 615
GluI GCNGC 1 cut(s) 579
GsaI CCCAGC 1 cut(s) 482
Hin1II CATG 7 cut(s) 239, 251, 278, 292, 354, 365, 609
HincII GTYRAC 1 cut(s) 79
HindII GTYRAC 1 cut(s) 79
HinfI GANTC 4 cut(s) 35, 106, 340, 415
HpaI GTTAAC 1 cut(s) 79
HphI GGTGA 3 cut(s) 76, 296, 484
Hpy166II GTNNAC 1 cut(s) 79
Hpy188I TCNGA 2 cut(s) 40, 499
Hpy188III TCNNGA 4 cut(s) 69, 110, 362, 419
Hpy8I GTNNAC 1 cut(s) 79
HpyAV CCTTC 2 cut(s) 314, 532
HpyCH4IV ACGT 2 cut(s) 18, 627
HpyCH4V TGCA 5 cut(s) 32, 195, 354, 384, 605
HpyF10VI GCNNNNNNNGC 2 cut(s) 446, 578
HpyF3I CTNAG 4 cut(s) 44, 179, 483, 496
HpySE526I ACGT 2 cut(s) 18, 627
Hsp92II CATG 7 cut(s) 239, 251, 278, 292, 354, 365, 609
KspAI GTTAAC 1 cut(s) 79
Kzo9I GATC 2 cut(s) 151, 489
LmnI GCTCC 1 cut(s) 256
Lsp1109I GCAGC 1 cut(s) 565
LweI GCATC 1 cut(s) 296
MaeI CTAG 4 cut(s) 167, 452, 474, 615
MaeII ACGT 2 cut(s) 18, 627
MaeIII GTNAC 2 cut(s) 284, 404
MalI GATC 2 cut(s) 153, 491
MboI GATC 2 cut(s) 151, 489
MboII GAAGA 1 cut(s) 499
MfeI CAATTG 1 cut(s) 573
MluCI AATT 4 cut(s) 64, 557, 573, 585
Mph1103I ATGCAT 2 cut(s) 356, 607
MseI TTAA 5 cut(s) 51, 78, 129, 210, 642
MspA1I CMGCKG 1 cut(s) 482
MspR9I CCNGG 2 cut(s) 122, 143
MunI CAATTG 1 cut(s) 573
MvaI CCWGG 2 cut(s) 122, 143
MwoI GCNNNNNNNGC 2 cut(s) 446, 578
NdeII GATC 2 cut(s) 151, 489
NlaIII CATG 7 cut(s) 239, 251, 278, 292, 354, 365, 609
NlaIV GGNNCC 1 cut(s) 548
NmuCI GTSAC 1 cut(s) 284
NsiI ATGCAT 2 cut(s) 356, 607
NspI RCATGY 5 cut(s) 251, 278, 292, 354, 609
PaeI GCATGC 1 cut(s) 251
PagI TCATGA 1 cut(s) 361
PciI ACATGT 2 cut(s) 274, 288
PfeI GAWTC 4 cut(s) 35, 106, 340, 415
PflMI CCANNNNNTGG 1 cut(s) 425
PkrI GCNGC 1 cut(s) 580
PpuMI RGGWCCY 1 cut(s) 546
PscI ACATGT 2 cut(s) 274, 288
Psp5II RGGWCCY 1 cut(s) 546
Psp6I CCWGG 2 cut(s) 120, 141
PspFI CCCAGC 1 cut(s) 478
PspGI CCWGG 2 cut(s) 120, 141
PspN4I GGNNCC 1 cut(s) 548
PspPI GGNCC 2 cut(s) 40, 546
PspPPI RGGWCCY 1 cut(s) 546
PvuII CAGCTG 1 cut(s) 482
SaqAI TTAA 5 cut(s) 51, 78, 129, 210, 642
SatI GCNGC 1 cut(s) 579
Sau3AI GATC 2 cut(s) 151, 489
Sau96I GGNCC 2 cut(s) 40, 546
ScrFI CCNGG 2 cut(s) 122, 143
SfaNI GCATC 1 cut(s) 296
SfcI CTRYAG 1 cut(s) 441
SinI GGWCC 2 cut(s) 40, 546
SpeI ACTAGT 1 cut(s) 451
SphI GCATGC 1 cut(s) 251
Sse9I AATT 4 cut(s) 64, 557, 573, 585
SspMI CTAG 4 cut(s) 167, 452, 474, 615
StyD4I CCNGG 2 cut(s) 120, 141
TaiI ACGT 2 cut(s) 21, 630
TasI AATT 4 cut(s) 64, 557, 573, 585
TfiI GAWTC 4 cut(s) 35, 106, 340, 415
Tru1I TTAA 5 cut(s) 51, 78, 129, 210, 642
Tru9I TTAA 5 cut(s) 51, 78, 129, 210, 642
TscAI CASTG 1 cut(s) 386
TseFI GTSAC 1 cut(s) 284
TseI GCWGC 1 cut(s) 578
Tsp45I GTSAC 1 cut(s) 284
TspDTI ATGAA 3 cut(s) 333, 350, 628
TspRI CASTG 1 cut(s) 386
Van91I CCANNNNNTGG 1 cut(s) 425
VpaK11BI GGWCC 2 cut(s) 40, 546
XagI CCTNNNNNAGG 1 cut(s) 140
XapI RAATTY 1 cut(s) 557
XceI RCATGY 5 cut(s) 251, 278, 292, 354, 609
XspI CTAG 4 cut(s) 167, 452, 474, 615
Zsp2I ATGCAT 2 cut(s) 356, 607
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.