Rmu_sc0038028.1_g000001

Dimerisation domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0038028.1
OG0000357
Physical Location & Seq
Reverse (-)
1 .. 547
547 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0038028.1_g000001.1.cds

Sequence Viewer

Length: 404 bp
ctggaaacaaaaccccaagccatagttcttgacgatgaaagaaagcaagaagaagaaagctttcattatgctgtgcagctggtggtttcatctgcgctgcccatgtccatgcaatcagccattgagctcggactttttgatatcatagccagagcaggttcgggtgcggggctctctgcaccccagattgctgcccagattggcacccagaatcctgaggcagcctttatgctggatcgaatccttaggctcctcgccactcactctgtacttggttgctctctggttgatggccaaaggctctacaggctctccgcggtgtccaagtactttgtgactgaagatggcgtttcgttgggcttcgtcatgtcattgttccaagacaaggtcttcataaacagttg
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Dimerisation

Protein Analysis

134

Amino Acids

14.55

Weight (kDa)

4.87

Isoelectric Point (pI)

44.97

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000357)

Species Orthologous Gene IDs
fragaria_vesca FvH4_7g17810 FvH4_7g17811 FvH4_7g17820 FvH4_7g17830
malus_domestica MD00G1100700.v1.1 MD01G1089600.v1.1 MD01G1089800.v1.1 MD01G1090400.v1.1 MD01G1090500.v1.1 MD01G1090800.v1.1 MD04G1141100.v1.1 MD07G1161000.v1.1 MD07G1161100.v1.1 MD10G1030000.v1.1 MD10G1030200.v1.1 MD15G1409200.v1.1 MD15G1409700.v1.1
prunus_persica Prupe.2G199100_v2.0.a1 Prupe.2G199100_v2.0.a1 Prupe.2G199300_v2.0.a1 Prupe.2G199400_v2.0.a1 Prupe.2G199400_v2.0.a1 Prupe.2G199500_v2.0.a1 Prupe.2G199600_v2.0.a1 Prupe.2G199600_v2.0.a1 Prupe.2G199800_v2.0.a1 Prupe.2G200100_v2.0.a1 Prupe.2G200100_v2.0.a1
pyrus_communis pycom01g11360 pycom01g11370 pycom01g11400 pycom01g11440 pycom01g11480 pycom01g11490 pycom07g15690 pycom08g12100
rosa_chinensis RchiOBHm_Chr1g0317931 RchiOBHm_Chr1g0361211 RchiOBHm_Chr1g0361221 RchiOBHm_Chr1g0361241 RchiOBHm_Chr1g0367691 RchiOBHm_Chr4g0390171 RchiOBHm_Chr4g0396271 RchiOBHm_Chr6g0286421
rosa_laevigata RLG00000002555 RLG00000009555 RLG00000027275 RLG00000027731 RLG00000027732 RLG00000027734 RLG00000027738 RLG00000030575
rosa_multiflora Rmu_co8470451.1_g000001 Rmu_sc0000250.1_g000010 Rmu_sc0010379.1_g000006 Rmu_sc0011132.1_g000005 Rmu_sc0011132.1_g000007 Rmu_sc0038028.1_g000001 Rmu_ssc0000008.1_g000043 Rmu_ssc0000234.1_g000002 Rmu_ssc0000418.1_g000001
rosa_roxburghii Rroxscaffold_2G00116370 Rroxscaffold_4G00289300 Rroxscaffold_4G00295130 Rroxscaffold_4G00295140 Rroxscaffold_4G00295160 Rroxscaffold_4G00295190 Rroxscaffold_4G00295220 Rroxscaffold_4G00330100 Rroxscaffold_5G00341100
rosa_rugosa Rorug01G0287600 Rorug01G0287700 Rorug01G0336200 Rorug01G0336200 Rorug03G0350700
rosa_samantha Rh1AG030300 Rh1AG298500 Rh1AG298600 Rh1AG298700 Rh1AG298900 Rh1BG262400 Rh1BG262500 Rh1BG262800 Rh1BG304800 Rh1CG029000 Rh1CG279800 Rh1CG279900 Rh1CG280000 Rh1CG280100 Rh1CG280200 Rh1CG320500 Rh1DG041200 Rh1DG292700 Rh1DG292800 Rh1DG337100 Rh3DG107500 Rh4AG128100 Rh4BG024900 Rh4CG072700 Rh4DG063000 Rh6CG295900 Rh6DG287700
rosa_wichuraiana Rw1G002290 Rw1G026410 Rw1G026420 Rw1G026440 Rw4G005440

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 146
AccB1I GGYRCC 1 cut(s) 203
AccII CGCG 1 cut(s) 317
AciI CCGC 3 cut(s) 167, 315, 317
AclWI GGATC 1 cut(s) 243
AcoI YGGCCR 1 cut(s) 292
AcuI CTGAAG 1 cut(s) 360
AfaI GTAC 2 cut(s) 270, 329
AfiI CCNNNNNNNGG 1 cut(s) 385
AjuI GAANNNNNNNTTGG 2 cut(s) 9, 41
AluBI AGCT 3 cut(s) 60, 79, 127
AluI AGCT 3 cut(s) 60, 79, 127
Alw21I GWGCWC 1 cut(s) 129
AlwI GGATC 1 cut(s) 243
AoxI GGCC 1 cut(s) 292
ApeKI GCWGC 4 cut(s) 76, 97, 191, 221
Asp700I GAANNNNTTC 1 cut(s) 60
AspLEI GCGC 1 cut(s) 97
AxyI CCTNAGG 2 cut(s) 216, 245
BalI TGGCCA 1 cut(s) 294
BanI GGYRCC 1 cut(s) 203
BanII GRGCYC 2 cut(s) 129, 174
BbsI GAAGAC 1 cut(s) 382
Bbv12I GWGCWC 1 cut(s) 129
BbvI GCAGC 4 cut(s) 84, 88, 178, 233
BccI CCATC 2 cut(s) 284, 338
BfmI CTRYAG 1 cut(s) 304
BfuAI ACCTGC 1 cut(s) 146
BisI GCNGC 4 cut(s) 77, 98, 192, 222
BlsI GCNGC 4 cut(s) 78, 99, 193, 223
BmcAI AGTACT 1 cut(s) 329
BmiI GGNNCC 2 cut(s) 205, 251
BpiI GAAGAC 1 cut(s) 382
BsaJI CCNNGG 1 cut(s) 315
BsaXI ACNNNNNCTCC 2 cut(s) 296, 326
Bsc4I CCNNNNNNNGG 1 cut(s) 385
Bse21I CCTNAGG 2 cut(s) 216, 245
BseDI CCNNGG 1 cut(s) 315
BseLI CCNNNNNNNGG 1 cut(s) 385
BseMII CTCAG 1 cut(s) 207
BseRI GAGGAG 1 cut(s) 242
BseXI GCAGC 4 cut(s) 84, 88, 178, 233
BsgI GTGCAG 2 cut(s) 95, 162
Bsh1236I CGCG 1 cut(s) 317
BshFI GGCC 1 cut(s) 294
BshNI GGYRCC 1 cut(s) 203
BsiHKAI GWGCWC 1 cut(s) 129
BslI CCNNNNNNNGG 1 cut(s) 385
BsnI GGCC 1 cut(s) 294
Bsp1286I GDGCHC 2 cut(s) 129, 174
Bsp143I GATC 1 cut(s) 235
BspACI CCGC 3 cut(s) 167, 315, 317
BspANI GGCC 1 cut(s) 294
BspCNI CTCAG 1 cut(s) 208
BspFNI CGCG 1 cut(s) 317
BspLI GGNNCC 2 cut(s) 205, 251
BspMI ACCTGC 1 cut(s) 146
BspPI GGATC 1 cut(s) 243
BspT107I GGYRCC 1 cut(s) 203
BssECI CCNNGG 1 cut(s) 315
BssMI GATC 1 cut(s) 235
Bst4CI ACNGT 1 cut(s) 401
BstDEI CTNAG 2 cut(s) 216, 245
BstDSI CCRYGG 1 cut(s) 315
BstFNI CGCG 1 cut(s) 317
BstHHI GCGC 1 cut(s) 97
BstKTI GATC 1 cut(s) 238
BstMBI GATC 1 cut(s) 235
BstMWI GCNNNNNNNGC 1 cut(s) 307
BstSFI CTRYAG 1 cut(s) 304
BstUI CGCG 1 cut(s) 317
BstV1I GCAGC 4 cut(s) 84, 88, 178, 233
BstV2I GAAGAC 1 cut(s) 382
Bsu36I CCTNAGG 2 cut(s) 216, 245
BsuRI GGCC 1 cut(s) 294
BtgI CCRYGG 1 cut(s) 315
BveI ACCTGC 1 cut(s) 146
CfoI GCGC 1 cut(s) 97
Cfr42I CCGCGG 1 cut(s) 318
Csp6I GTAC 2 cut(s) 269, 328
CviAII CATG 3 cut(s) 103, 109, 367
CviQI GTAC 2 cut(s) 269, 328
DdeI CTNAG 2 cut(s) 216, 245
DpnI GATC 1 cut(s) 237
DpnII GATC 1 cut(s) 235
EaeI YGGCCR 1 cut(s) 292
Ecl136II GAGCTC 1 cut(s) 127
Eco24I GRGCYC 2 cut(s) 129, 174
Eco32I GATATC 1 cut(s) 142
Eco53kI GAGCTC 1 cut(s) 127
Eco57I CTGAAG 1 cut(s) 360
Eco81I CCTNAGG 2 cut(s) 216, 245
EcoICRI GAGCTC 1 cut(s) 127
EcoRV GATATC 1 cut(s) 142
EcoT38I GRGCYC 2 cut(s) 129, 174
FaeI CATG 3 cut(s) 106, 112, 370
FaiI YATR 8 cut(s) 23, 69, 104, 110, 146, 230, 368, 395
FatI CATG 3 cut(s) 102, 108, 366
FauI CCCGC 1 cut(s) 160
Fnu4HI GCNGC 4 cut(s) 77, 98, 192, 222
FriOI GRGCYC 2 cut(s) 129, 174
Fsp4HI GCNGC 4 cut(s) 77, 98, 192, 222
GlaI GCGC 1 cut(s) 96
GluI GCNGC 4 cut(s) 77, 98, 192, 222
HaeIII GGCC 1 cut(s) 294
HhaI GCGC 1 cut(s) 97
Hin1II CATG 3 cut(s) 106, 112, 370
Hin6I GCGC 1 cut(s) 95
HinP1I GCGC 1 cut(s) 95
HindIII AAGCTT 1 cut(s) 58
HinfI GANTC 2 cut(s) 211, 240
Hpy188I TCNGA 1 cut(s) 131
Hpy188III TCNNGA 2 cut(s) 29, 215
HpyCH4III ACNGT 1 cut(s) 401
HpyCH4V TGCA 3 cut(s) 76, 112, 179
HpyF10VI GCNNNNNNNGC 1 cut(s) 307
HpyF3I CTNAG 2 cut(s) 216, 245
Hsp92II CATG 3 cut(s) 106, 112, 370
HspAI GCGC 1 cut(s) 95
KspI CCGCGG 1 cut(s) 318
Kzo9I GATC 1 cut(s) 235
LmnI GCTCC 1 cut(s) 255
Lsp1109I GCAGC 4 cut(s) 84, 88, 178, 233
MaeIII GTNAC 1 cut(s) 334
MalI GATC 1 cut(s) 237
MboI GATC 1 cut(s) 235
MboII GAAGA 4 cut(s) 62, 65, 353, 382
MhlI GDGCHC 2 cut(s) 129, 174
MlsI TGGCCA 1 cut(s) 294
MluNI TGGCCA 1 cut(s) 294
MnlI CCTC 2 cut(s) 211, 263
Mox20I TGGCCA 1 cut(s) 294
MroXI GAANNNNTTC 1 cut(s) 60
MscI TGGCCA 1 cut(s) 294
MslI CAYNNNNRTG 1 cut(s) 107
Msp20I TGGCCA 1 cut(s) 294
MspA1I CMGCKG 2 cut(s) 79, 317
MvnI CGCG 1 cut(s) 317
MwoI GCNNNNNNNGC 1 cut(s) 307
NdeII GATC 1 cut(s) 235
NlaIII CATG 3 cut(s) 106, 112, 370
NlaIV GGNNCC 2 cut(s) 205, 251
NmuCI GTSAC 1 cut(s) 334
PdmI GAANNNNTTC 1 cut(s) 60
PfeI GAWTC 2 cut(s) 211, 240
PflFI GACNNNGTC 1 cut(s) 386
PkrI GCNGC 4 cut(s) 78, 99, 193, 223
Psp124BI GAGCTC 1 cut(s) 129
PspN4I GGNNCC 2 cut(s) 205, 251
PsyI GACNNNGTC 1 cut(s) 386
PvuII CAGCTG 1 cut(s) 79
RsaI GTAC 2 cut(s) 270, 329
RsaNI GTAC 2 cut(s) 269, 328
RseI CAYNNNNRTG 1 cut(s) 107
SacI GAGCTC 1 cut(s) 129
SacII CCGCGG 1 cut(s) 318
SatI GCNGC 4 cut(s) 77, 98, 192, 222
Sau3AI GATC 1 cut(s) 235
ScaI AGTACT 1 cut(s) 329
SduI GDGCHC 2 cut(s) 129, 174
SetI ASST 5 cut(s) 62, 81, 129, 160, 390
SfcI CTRYAG 1 cut(s) 304
Sfr303I CCGCGG 1 cut(s) 318
SgrBI CCGCGG 1 cut(s) 318
SmiMI CAYNNNNRTG 1 cut(s) 107
SsiI CCGC 3 cut(s) 167, 315, 317
SstI GAGCTC 1 cut(s) 129
TaaI ACNGT 1 cut(s) 401
TaqI TCGA 1 cut(s) 238
TatI WGTACW 2 cut(s) 268, 327
TfiI GAWTC 2 cut(s) 211, 240
TseFI GTSAC 1 cut(s) 334
TseI GCWGC 4 cut(s) 76, 97, 191, 221
Tsp45I GTSAC 1 cut(s) 334
TspDTI ATGAA 4 cut(s) 51, 53, 78, 382
Tth111I GACNNNGTC 1 cut(s) 386
XmnI GAANNNNTTC 1 cut(s) 60
ZrmI AGTACT 1 cut(s) 329
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.