MD12G1142400.v1.1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr12
OG0001250
Physical Location & Seq
Forward (+)
22159971 .. 22160445
475 bp
Loading structure...
UTR
Exon/CDS
Intron
MD12G1142400.v1.1.491

Sequence Viewer

Length: 282 bp
ATGAGGTACAGGCCCCTGTTGATTTCTTTTACAAAGGCAAAAACAGCAGAGTTGAAGGCGAGGTGGCCAGAGAATACAGACCGTGGAAACCCCGAAAACATGCGGATTGTAGTATACCAACCGCCTCAAGATGCTGACCCCATGAATATGACACCAAACATCCATGTAGAACAAGTCCAAGACAAGCCGGCAAGATCGCCGACCACGGTGATCGATGAGGACATGGGTGTCATTTGGACTTCCCAAAGAACTTTGGGAGGATTTAATGACGAGGTGAGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

94

Amino Acids

10.64

Weight (kDa)

5.28

Isoelectric Point (pI)

40.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 227
AccI GTMKAC 1 cut(s) 114
AciI CCGC 2 cut(s) 103, 122
AcoI YGGCCR 1 cut(s) 65
AfaI GTAC 1 cut(s) 8
AgsI TTSAA 1 cut(s) 55
AoxI GGCC 2 cut(s) 11, 65
AspS9I GGNCC 1 cut(s) 12
AsuHPI GGTGA 1 cut(s) 220
BalI TGGCCA 1 cut(s) 67
BmgT120I GGNCC 1 cut(s) 12
BmiI GGNNCC 1 cut(s) 14
BmsI GCATC 1 cut(s) 121
BpuEI CTTGAG 1 cut(s) 111
Bsa29I ATCGAT 1 cut(s) 213
BsaJI CCNNGG 2 cut(s) 82, 204
Bse118I RCCGGY 1 cut(s) 187
BseCI ATCGAT 1 cut(s) 213
BseDI CCNNGG 2 cut(s) 82, 204
BseGI GGATG 1 cut(s) 159
BshFI GGCC 2 cut(s) 13, 67
BshVI ATCGAT 1 cut(s) 213
BsiSI CCGG 1 cut(s) 188
BsnI GGCC 2 cut(s) 13, 67
Bsp143I GATC 2 cut(s) 194, 210
BspACI CCGC 2 cut(s) 103, 122
BspANI GGCC 2 cut(s) 13, 67
BspDI ATCGAT 1 cut(s) 213
BspLI GGNNCC 1 cut(s) 14
BsrFI RCCGGY 1 cut(s) 187
BssAI RCCGGY 1 cut(s) 187
BssECI CCNNGG 2 cut(s) 82, 204
BssMI GATC 2 cut(s) 194, 210
BssNAI GTATAC 1 cut(s) 115
Bst1107I GTATAC 1 cut(s) 115
Bst4CI ACNGT 2 cut(s) 83, 208
BstC8I GCNNGC 1 cut(s) 189
BstDSI CCRYGG 2 cut(s) 82, 204
BstF5I GGATG 1 cut(s) 159
BstKTI GATC 2 cut(s) 197, 213
BstMBI GATC 2 cut(s) 194, 210
BstMWI GCNNNNNNNGC 1 cut(s) 44
BstNSI RCATGY 1 cut(s) 103
BstZ17I GTATAC 1 cut(s) 115
Bsu15I ATCGAT 1 cut(s) 213
BsuRI GGCC 2 cut(s) 13, 67
BsuTUI ATCGAT 1 cut(s) 213
BtgI CCRYGG 2 cut(s) 82, 204
BtsCI GGATG 1 cut(s) 159
Cac8I GCNNGC 1 cut(s) 189
Cfr10I RCCGGY 1 cut(s) 187
Cfr13I GGNCC 1 cut(s) 12
ClaI ATCGAT 1 cut(s) 213
Csp6I GTAC 1 cut(s) 7
CviAII CATG 4 cut(s) 100, 142, 164, 223
CviJI RGCY 3 cut(s) 13, 67, 187
CviKI_1 RGCY 3 cut(s) 13, 67, 187
CviQI GTAC 1 cut(s) 7
DpnI GATC 2 cut(s) 196, 212
DpnII GATC 2 cut(s) 194, 210
DrdI GACNNNNNNGTC 1 cut(s) 227
DseDI GACNNNNNNGTC 1 cut(s) 227
EaeI YGGCCR 1 cut(s) 65
EcoO109I RGGNCCY 1 cut(s) 12
FaeI CATG 4 cut(s) 103, 145, 167, 226
FaiI YATR 6 cut(s) 101, 115, 143, 149, 165, 224
FatI CATG 4 cut(s) 99, 141, 163, 222
FblI GTMKAC 1 cut(s) 114
FokI GGATG 1 cut(s) 146
HaeIII GGCC 2 cut(s) 13, 67
HapII CCGG 1 cut(s) 188
Hin1II CATG 4 cut(s) 103, 145, 167, 226
HpaII CCGG 1 cut(s) 188
HphI GGTGA 1 cut(s) 220
Hpy166II GTNNAC 1 cut(s) 115
Hpy188III TCNNGA 1 cut(s) 128
Hpy8I GTNNAC 1 cut(s) 115
HpyAV CCTTC 1 cut(s) 49
HpyCH4III ACNGT 2 cut(s) 83, 208
HpyF10VI GCNNNNNNNGC 1 cut(s) 44
Hsp92II CATG 4 cut(s) 103, 145, 167, 226
KroI GCCGGC 1 cut(s) 187
KroNI GCCGGC 1 cut(s) 189
Kzo9I GATC 2 cut(s) 194, 210
LpnPI CCDG 3 cut(s) 29, 81, 201
LweI GCATC 1 cut(s) 121
MalI GATC 2 cut(s) 196, 212
MboI GATC 2 cut(s) 194, 210
MlsI TGGCCA 1 cut(s) 67
MluNI TGGCCA 1 cut(s) 67
MnlI CCTC 5 cut(s) 54, 135, 211, 251, 265
Mox20I TGGCCA 1 cut(s) 67
MroNI GCCGGC 1 cut(s) 187
MscI TGGCCA 1 cut(s) 67
MseI TTAA 1 cut(s) 264
MslI CAYNNNNRTG 1 cut(s) 146
Msp20I TGGCCA 1 cut(s) 67
MspI CCGG 1 cut(s) 188
MwoI GCNNNNNNNGC 1 cut(s) 44
NaeI GCCGGC 1 cut(s) 189
NdeII GATC 2 cut(s) 194, 210
NgoMIV GCCGGC 1 cut(s) 187
NlaIII CATG 4 cut(s) 103, 145, 167, 226
NlaIV GGNNCC 1 cut(s) 14
NspI RCATGY 1 cut(s) 103
PdiI GCCGGC 1 cut(s) 189
PspN4I GGNNCC 1 cut(s) 14
PspPI GGNCC 1 cut(s) 12
RsaI GTAC 1 cut(s) 8
RsaNI GTAC 1 cut(s) 7
RseI CAYNNNNRTG 1 cut(s) 146
SaqAI TTAA 1 cut(s) 264
Sau3AI GATC 2 cut(s) 194, 210
Sau96I GGNCC 1 cut(s) 12
SetI ASST 3 cut(s) 8, 65, 276
SfaNI GCATC 1 cut(s) 121
SmiMI CAYNNNNRTG 1 cut(s) 146
SmlI CTYRAG 1 cut(s) 126
SmoI CTYRAG 1 cut(s) 126
SsiI CCGC 2 cut(s) 103, 122
TaaI ACNGT 2 cut(s) 83, 208
TaqI TCGA 1 cut(s) 213
Tru1I TTAA 1 cut(s) 264
Tru9I TTAA 1 cut(s) 264
TspDTI ATGAA 1 cut(s) 158
XceI RCATGY 1 cut(s) 103
XmiI GTMKAC 1 cut(s) 114
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.