Rw4G015120

No description available

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr4
Physical Location & Seq
Reverse (-)
34828815 .. 34829929
1115 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw4G015120.1

Sequence Viewer

Length: 252 bp
ATGGTGGTGAGGGGAAAAAGAAAACGAGTTGAAACCATACCAGCAGGTGAAATTGAAGTTTCATTCAAACTTTCTAGTGATTGCTATTCCAATCAGAGGCACAATGAGAAGGAAAGAGAAAATGAGACTTCTAGTAGTGCTCCTTGTCATTTGTCTTTCTTTGAGAGACTCGAAGGATGGAAGCTCGAGCGCAAACAAAGATGCAAGGGACAAATCGACACGATCTCATTATATCTTAAATCTCCTACATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

83

Amino Acids

9.67

Weight (kDa)

9.15

Isoelectric Point (pI)

42.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 35
Acc36I ACCTGC 1 cut(s) 35
AfiI CCNNNNNNNGG 1 cut(s) 96
AgsI TTSAA 3 cut(s) 32, 56, 67
AluBI AGCT 1 cut(s) 184
AluI AGCT 1 cut(s) 184
Alw21I GWGCWC 1 cut(s) 142
Alw26I GTCTC 2 cut(s) 119, 160
Ama87I CYCGRG 1 cut(s) 185
AspLEI GCGC 1 cut(s) 192
AsuHPI GGTGA 2 cut(s) 19, 59
AvaI CYCGRG 1 cut(s) 185
Bbv12I GWGCWC 1 cut(s) 142
BccI CCATC 1 cut(s) 171
BcoDI GTCTC 2 cut(s) 119, 160
BfaI CTAG 2 cut(s) 75, 132
BfuAI ACCTGC 1 cut(s) 35
BmeT110I CYCGRG 1 cut(s) 185
BmsI GCATC 1 cut(s) 191
Bsc4I CCNNNNNNNGG 1 cut(s) 96
BseGI GGATG 1 cut(s) 182
BseLI CCNNNNNNNGG 1 cut(s) 96
BsiHKAI GWGCWC 1 cut(s) 142
BsiHKCI CYCGRG 1 cut(s) 185
BslFI GGGAC 1 cut(s) 222
BslI CCNNNNNNNGG 1 cut(s) 96
BsmAI GTCTC 2 cut(s) 119, 160
BsmFI GGGAC 1 cut(s) 222
BsoBI CYCGRG 1 cut(s) 185
Bsp1286I GDGCHC 1 cut(s) 142
Bsp143I GATC 1 cut(s) 222
BspMI ACCTGC 1 cut(s) 35
BssMI GATC 1 cut(s) 222
BstF5I GGATG 1 cut(s) 182
BstHHI GCGC 1 cut(s) 192
BstKTI GATC 1 cut(s) 225
BstMAI GTCTC 2 cut(s) 119, 160
BstMBI GATC 1 cut(s) 222
BtsCI GGATG 1 cut(s) 182
BveI ACCTGC 1 cut(s) 35
CfoI GCGC 1 cut(s) 192
CviJI RGCY 1 cut(s) 184
CviKI_1 RGCY 1 cut(s) 184
DpnI GATC 1 cut(s) 224
DpnII GATC 1 cut(s) 222
Eco88I CYCGRG 1 cut(s) 185
FaiI YATR 3 cut(s) 38, 232, 250
FaqI GGGAC 1 cut(s) 222
FokI GGATG 1 cut(s) 189
FspBI CTAG 2 cut(s) 75, 132
GlaI GCGC 1 cut(s) 191
HhaI GCGC 1 cut(s) 192
Hin6I GCGC 1 cut(s) 190
HinP1I GCGC 1 cut(s) 190
HinfI GANTC 1 cut(s) 168
HphI GGTGA 2 cut(s) 19, 59
Hpy188I TCNGA 1 cut(s) 96
HpyAV CCTTC 2 cut(s) 103, 167
HpyCH4V TGCA 1 cut(s) 204
HspAI GCGC 1 cut(s) 190
Kzo9I GATC 1 cut(s) 222
LmnI GCTCC 1 cut(s) 145
LpnPI CCDG 2 cut(s) 30, 54
LweI GCATC 1 cut(s) 191
MaeI CTAG 2 cut(s) 75, 132
MalI GATC 1 cut(s) 224
MboI GATC 1 cut(s) 222
MhlI GDGCHC 1 cut(s) 142
MluCI AATT 1 cut(s) 51
MlyI GAGTC 1 cut(s) 162
MnlI CCTC 2 cut(s) 3, 90
MseI TTAA 1 cut(s) 237
NdeII GATC 1 cut(s) 222
PaeR7I CTCGAG 1 cut(s) 185
PaqCI CACCTGC 1 cut(s) 35
PleI GAGTC 1 cut(s) 162
PpsI GAGTC 1 cut(s) 162
PspXI VCTCGAGB 1 cut(s) 185
SaqAI TTAA 1 cut(s) 237
Sau3AI GATC 1 cut(s) 222
SchI GAGTC 1 cut(s) 162
SduI GDGCHC 1 cut(s) 142
SetI ASST 2 cut(s) 49, 186
SfaNI GCATC 1 cut(s) 191
Sfr274I CTCGAG 1 cut(s) 185
SlaI CTCGAG 1 cut(s) 185
SmlI CTYRAG 1 cut(s) 185
SmoI CTYRAG 1 cut(s) 185
Sse9I AATT 1 cut(s) 51
SspMI CTAG 2 cut(s) 75, 132
TaqI TCGA 3 cut(s) 171, 186, 216
TasI AATT 1 cut(s) 51
Tru1I TTAA 1 cut(s) 237
Tru9I TTAA 1 cut(s) 237
TspDTI ATGAA 1 cut(s) 51
XhoI CTCGAG 1 cut(s) 185
XspI CTAG 2 cut(s) 75, 132
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.