Basic Information

Type: gene

Biological Identity

Species

rosa_wichuraiana

Chromosome

Chr6

Orthogroup ID

OG0001250

Physical Location & Seq

Genomic Coordinates Reverse (-)

53832614 .. 53834773

Gene Structure 2160 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rw6G029820.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 246 bp

ATGCGTCAATTTTCCTTTGTTGAAAGGCTGAAAGGGTGGAAAATCGAGGTCAGACAAAGACAAAATAATCAGACGTTTGACTCGACTATAGAGGTGGTAGGTTTTATCCTCGATGAAGATCCAACGGCTGTGAAATTCGAAAAGAGAGACAACATCTTTAGCAAGGAAGAATCTAATAACAAAAGAATCAAGATGGAGGGGAAAGAAATTACAACAGAAGAAATTGAGGATTTTCAATATCCATGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

81

Amino Acids

9.76

Weight (kDa)

5.03

Isoelectric Point (pI)

75.57

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001250)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_4g02611 FvH4_4g02612 FvH4_5g14730 FvH4_5g20350 FvH4_6g23221
malus_domestica	MD12G1142400.v1.1
prunus_persica	Prupe.6G255700_v2.0.a1
pyrus_communis	pycom12g13720
rosa_laevigata	RLG00000009914 RLG00000009922 RLG00000009923 RLG00000022757 RLG00000023405 RLG00000023428
rosa_multiflora	Rmu_sc0001380.1_g000014 Rmu_sc0006160.1_g000004 Rmu_sc0007142.1_g000001 Rmu_sc0038645.1_g000001
rosa_roxburghii	Rroxscaffold_5G00336460 Rroxscaffold_5G00336470 Rroxscaffold_5G00336560 Rroxscaffold_6G00392190 Rroxscaffold_6G00400500
rosa_rugosa	Rorug03G0191200 Rorug03G0330500 Rorug03G0330600
rosa_samantha	Rh2AG375900 Rh2CG353800 Rh3AG242100 Rh3AG305100 Rh3BG275700 Rh3BG277200 Rh3BG318200 Rh3CG338600 Rh3DG269100 Rh3DG340600 Rh4AG032000 Rh4AG032100 Rh4AG032700 Rh4AG181000 Rh4BG026100 Rh4BG026200 Rh4BG180200 Rh4CG035100 Rh4CG035200 Rh4CG035600 Rh4CG036600 Rh4CG192100 Rh4DG027700 Rh4DG027800 Rh4DG028400 Rh4DG176300
rosa_wichuraiana	Rw0G002680 Rw3G021640 Rw4G015120 Rw6G029820

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	113
AcsI	RAATTY	1 cut(s)	134
AgsI	TTSAA	2 cut(s)	23, 236
Alw26I	GTCTC	1 cut(s)	141
AlwI	GGATC	1 cut(s)	113
ApoI	RAATTY	1 cut(s)	134
AsuII	TTCGAA	1 cut(s)	138
BccI	CCATC	1 cut(s)	187
BceAI	ACGGC	1 cut(s)	141
BcoDI	GTCTC	1 cut(s)	141
BfmI	CTRYAG	1 cut(s)	87
Bpu14I	TTCGAA	1 cut(s)	138
BsaBI	GATNNNNATC	1 cut(s)	117
Bse8I	GATNNNNATC	1 cut(s)	117
BseJI	GATNNNNATC	1 cut(s)	117
BsmAI	GTCTC	1 cut(s)	141
Bsp119I	TTCGAA	1 cut(s)	138
Bsp143I	GATC	1 cut(s)	118
BspPI	GGATC	1 cut(s)	113
BspT104I	TTCGAA	1 cut(s)	138
BssMI	GATC	1 cut(s)	118
BstBI	TTCGAA	1 cut(s)	138
BstKTI	GATC	1 cut(s)	121
BstMAI	GTCTC	1 cut(s)	141
BstMBI	GATC	1 cut(s)	118
BstSFI	CTRYAG	1 cut(s)	87
BstX2I	RGATCY	1 cut(s)	118
BstYI	RGATCY	1 cut(s)	118
CviAII	CATG	1 cut(s)	243
CviJI	RGCY	2 cut(s)	28, 128
CviKI_1	RGCY	2 cut(s)	28, 128
DpnI	GATC	1 cut(s)	120
DpnII	GATC	1 cut(s)	118
FaeI	CATG	1 cut(s)	246
FaiI	YATR	2 cut(s)	89, 244
FatI	CATG	1 cut(s)	242
Hin1II	CATG	1 cut(s)	246
HinfI	GANTC	3 cut(s)	80, 170, 186
Hpy188I	TCNGA	2 cut(s)	53, 72
Hpy188III	TCNNGA	1 cut(s)	190
HpyCH4IV	ACGT	1 cut(s)	74
HpySE526I	ACGT	1 cut(s)	74
Hsp92II	CATG	1 cut(s)	246
Kzo9I	GATC	1 cut(s)	118
MaeII	ACGT	1 cut(s)	74
MalI	GATC	1 cut(s)	120
MboI	GATC	1 cut(s)	118
MboII	GAAGA	3 cut(s)	128, 179, 230
MflI	RGATCY	1 cut(s)	118
MluCI	AATT	4 cut(s)	8, 134, 207, 222
MlyI	GAGTC	1 cut(s)	74
MmeI	TCCRAC	1 cut(s)	146
MnlI	CCTC	5 cut(s)	40, 85, 119, 190, 220
NdeII	GATC	1 cut(s)	118
NlaIII	CATG	1 cut(s)	246
NspV	TTCGAA	1 cut(s)	138
PcsI	WCGNNNNNNNCGW	1 cut(s)	80
PfeI	GAWTC	2 cut(s)	170, 186
PleI	GAGTC	1 cut(s)	74
PpsI	GAGTC	1 cut(s)	74
PsuI	RGATCY	1 cut(s)	118
Sau3AI	GATC	1 cut(s)	118
SchI	GAGTC	1 cut(s)	74
SetI	ASST	4 cut(s)	51, 77, 96, 103
SfcI	CTRYAG	1 cut(s)	87
SfuI	TTCGAA	1 cut(s)	138
SgeI	CNNG	5 cut(s)	58, 94, 122, 175, 202
Sse9I	AATT	4 cut(s)	8, 134, 207, 222
TaiI	ACGT	1 cut(s)	77
TaqI	TCGA	4 cut(s)	45, 83, 111, 138
TasI	AATT	4 cut(s)	8, 134, 207, 222
TfiI	GAWTC	2 cut(s)	170, 186
TspDTI	ATGAA	1 cut(s)	129
XapI	RAATTY	1 cut(s)	134

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.