Rh4BG180200

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4B
OG0001250
Physical Location & Seq
Reverse (-)
31834893 .. 31836919
2027 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4BG180200.1

Sequence Viewer

Length: 156 bp
ATGATGTCTACTTCTGATCATGAAGATCTCAGATCGATATTAACCAACATGGTGGTGAAATCAAAATCAATTCTGGAATGCTTATTTCCAGTAGCTGATGAAACAAAAACTAATCATCAAAGGACATCAACAAGTCTGAGGGGAAAAAGAAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

51

Amino Acids

5.82

Weight (kDa)

9.51

Isoelectric Point (pI)

60.24

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 8
AluBI AGCT 1 cut(s) 95
AluI AGCT 1 cut(s) 95
AlwNI CAGNNNCTG 1 cut(s) 95
AsuHPI GGTGA 1 cut(s) 67
BclI TGATCA 1 cut(s) 16
BglII AGATCT 1 cut(s) 25
Bsa29I ATCGAT 1 cut(s) 35
Bse1I ACTGG 1 cut(s) 89
BseCI ATCGAT 1 cut(s) 35
BseMII CTCAG 2 cut(s) 43, 128
BseNI ACTGG 1 cut(s) 89
BshVI ATCGAT 1 cut(s) 35
BsmI GAATGC 1 cut(s) 83
Bsp143I GATC 3 cut(s) 16, 25, 32
BspCNI CTCAG 2 cut(s) 42, 129
BspDI ATCGAT 1 cut(s) 35
BspHI TCATGA 1 cut(s) 19
BsrI ACTGG 1 cut(s) 89
BssMI GATC 3 cut(s) 16, 25, 32
BstDEI CTNAG 2 cut(s) 29, 137
BstKTI GATC 3 cut(s) 19, 28, 35
BstMBI GATC 3 cut(s) 16, 25, 32
BstX2I RGATCY 1 cut(s) 25
BstXI CCANNNNNNTGG 1 cut(s) 52
BstYI RGATCY 1 cut(s) 25
Bsu15I ATCGAT 1 cut(s) 35
BsuTUI ATCGAT 1 cut(s) 35
CaiI CAGNNNCTG 1 cut(s) 95
CciI TCATGA 1 cut(s) 19
ClaI ATCGAT 1 cut(s) 35
CviAII CATG 2 cut(s) 20, 49
CviJI RGCY 1 cut(s) 95
CviKI_1 RGCY 1 cut(s) 95
DdeI CTNAG 2 cut(s) 29, 137
DpnI GATC 3 cut(s) 18, 27, 34
DpnII GATC 3 cut(s) 16, 25, 32
FaeI CATG 2 cut(s) 23, 52
FaiI YATR 2 cut(s) 21, 50
FatI CATG 2 cut(s) 19, 48
FbaI TGATCA 1 cut(s) 16
FblI GTMKAC 1 cut(s) 8
FspEI CC 9 cut(s) 35, 38, 58, 59, 102, 106, 124, 125, 126
Hin1II CATG 2 cut(s) 23, 52
HphI GGTGA 1 cut(s) 67
Hpy166II GTNNAC 1 cut(s) 9
Hpy188I TCNGA 3 cut(s) 16, 32, 138
Hpy188III TCNNGA 2 cut(s) 20, 74
Hpy8I GTNNAC 1 cut(s) 9
HpyF3I CTNAG 2 cut(s) 29, 137
Hsp92II CATG 2 cut(s) 23, 52
Ksp22I TGATCA 1 cut(s) 16
Kzo9I GATC 3 cut(s) 16, 25, 32
LpnPI CCDG 2 cut(s) 59, 102
MalI GATC 3 cut(s) 18, 27, 34
MboI GATC 3 cut(s) 16, 25, 32
MboII GAAGA 1 cut(s) 35
MflI RGATCY 1 cut(s) 25
MluCI AATT 1 cut(s) 69
MnlI CCTC 1 cut(s) 132
MseI TTAA 1 cut(s) 41
MslI CAYNNNNRTG 1 cut(s) 53
Mva1269I GAATGC 1 cut(s) 83
NdeII GATC 3 cut(s) 16, 25, 32
NlaIII CATG 2 cut(s) 23, 52
PagI TCATGA 1 cut(s) 19
PctI GAATGC 1 cut(s) 83
PstNI CAGNNNCTG 1 cut(s) 95
PsuI RGATCY 1 cut(s) 25
RseI CAYNNNNRTG 1 cut(s) 53
SaqAI TTAA 1 cut(s) 41
Sau3AI GATC 3 cut(s) 16, 25, 32
SetI ASST 1 cut(s) 97
SgeI CNNG 5 cut(s) 32, 61, 86, 101, 144
SmiMI CAYNNNNRTG 1 cut(s) 53
Sse9I AATT 1 cut(s) 69
TaqI TCGA 1 cut(s) 35
TasI AATT 1 cut(s) 69
Tru1I TTAA 1 cut(s) 41
Tru9I TTAA 1 cut(s) 41
TspDTI ATGAA 2 cut(s) 36, 114
XmiI GTMKAC 1 cut(s) 8
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.