Prupe.1G183900_v2.0.a1

MULE transposase domain

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp01
Physical Location & Seq
Forward (+)
16446104 .. 16447857
1754 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.1G183900.1

Sequence Viewer

Length: 639 bp
ATGACAACAAGAAGGTGTATTCGTACCTCTACAAATGGTGCTGAAATTGCGGAGAATGAAATTCTCTCGCACAGAAGCAGAGAAGTTGGGTTTTTCAACCTCCTGAATGGGATTAATAGTCAAATGTTAGAGGGGTTTCGCATTGTTAAAAATAAAATTTATGCACGCGACAGCAGGGGTGTTGGGGGCGGGAACCTTGGCAACAACTTCAACGGGGGATTCACATTTCTTCTTGTTCTTATTGCACTTGTTCTGTTATTGGGATTATTGGGATTTGCATACTACCTAACAAGTACTAAAAGTGAAATGTCTAGATTGACAATTTTGATTAGCTACGGTGGGAGGTGGGTTGACTCAAGGTACGAAAATTTCAAAGCTAAAGGAGTACTCGTTTCCAATACAATTACATTGAAGGAGCTTCAGAAGCAAGTATATGACATTGTCAATGTGGACCCAAATGACTATGAGATAACTATGATAGCTATGTATGAAACAATGAAAAGCGCATGGCCTGTAGAGATAGCCGATGATGATGATGTGAGAGCTTTTATTTTTCAAAGTCGTTTAAGTTCTTCTAAGATTCCATTGTGCATTACATTGGAGGAGACCAACCTTGGGGGGTCCCCACAAGCTCCCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

213

Amino Acids

23.67

Weight (kDa)

6.61

Isoelectric Point (pI)

38.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 168
AciI CCGC 2 cut(s) 50, 189
AcsI RAATTY 3 cut(s) 60, 156, 367
AcuI CTGAAG 1 cut(s) 404
AfaI GTAC 4 cut(s) 25, 295, 362, 387
AfiI CCNNNNNNNGG 1 cut(s) 615
AgsI TTSAA 5 cut(s) 97, 211, 373, 412, 557
AluBI AGCT 6 cut(s) 333, 377, 418, 482, 545, 632
AluI AGCT 6 cut(s) 333, 377, 418, 482, 545, 632
Alw26I GTCTC 1 cut(s) 599
AoxI GGCC 1 cut(s) 509
ApoI RAATTY 3 cut(s) 60, 156, 367
AseI ATTAAT 1 cut(s) 114
AspLEI GCGC 1 cut(s) 506
AspS9I GGNCC 2 cut(s) 451, 621
AvaII GGWCC 2 cut(s) 451, 621
BcoDI GTCTC 1 cut(s) 599
BfaI CTAG 1 cut(s) 312
BfmI CTRYAG 1 cut(s) 513
BmcAI AGTACT 2 cut(s) 295, 387
Bme18I GGWCC 2 cut(s) 451, 621
BmgT120I GGNCC 2 cut(s) 451, 621
BmiI GGNNCC 4 cut(s) 194, 453, 622, 623
BpuEI CTTGAG 1 cut(s) 340
BsaI GGTCTC 1 cut(s) 599
BsaJI CCNNGG 2 cut(s) 196, 613
BsaXI ACNNNNNCTCC 2 cut(s) 375, 405
Bsc4I CCNNNNNNNGG 1 cut(s) 615
BseDI CCNNGG 2 cut(s) 196, 613
BseLI CCNNNNNNNGG 1 cut(s) 615
BseRI GAGGAG 1 cut(s) 617
Bsh1236I CGCG 1 cut(s) 168
BshFI GGCC 1 cut(s) 511
BslFI GGGAC 1 cut(s) 607
BslI CCNNNNNNNGG 1 cut(s) 615
BsmAI GTCTC 1 cut(s) 599
BsmFI GGGAC 1 cut(s) 607
BsnI GGCC 1 cut(s) 511
Bso31I GGTCTC 1 cut(s) 599
BspACI CCGC 2 cut(s) 50, 189
BspANI GGCC 1 cut(s) 511
BspFNI CGCG 1 cut(s) 168
BspLI GGNNCC 4 cut(s) 194, 453, 622, 623
BspTNI GGTCTC 1 cut(s) 599
BssECI CCNNGG 2 cut(s) 196, 613
BssT1I CCWWGG 2 cut(s) 196, 613
Bst4CI ACNGT 1 cut(s) 338
BstC8I GCNNGC 1 cut(s) 166
BstDEI CTNAG 1 cut(s) 576
BstFNI CGCG 1 cut(s) 168
BstHHI GCGC 1 cut(s) 506
BstMAI GTCTC 1 cut(s) 599
BstMWI GCNNNNNNNGC 2 cut(s) 47, 424
BstSFI CTRYAG 1 cut(s) 513
BstUI CGCG 1 cut(s) 168
BsuRI GGCC 1 cut(s) 511
Cac8I GCNNGC 1 cut(s) 166
CfoI GCGC 1 cut(s) 506
Cfr13I GGNCC 2 cut(s) 451, 621
Csp6I GTAC 4 cut(s) 24, 294, 361, 386
CviAII CATG 1 cut(s) 507
CviJI RGCY 8 cut(s) 333, 377, 418, 482, 511, 524, 545, 632
CviKI_1 RGCY 8 cut(s) 333, 377, 418, 482, 511, 524, 545, 632
CviQI GTAC 4 cut(s) 24, 294, 361, 386
DdeI CTNAG 1 cut(s) 576
Eco130I CCWWGG 2 cut(s) 196, 613
Eco31I GGTCTC 1 cut(s) 599
Eco47I GGWCC 2 cut(s) 451, 621
Eco57I CTGAAG 1 cut(s) 404
EcoO109I RGGNCCY 1 cut(s) 621
EcoT14I CCWWGG 2 cut(s) 196, 613
ErhI CCWWGG 2 cut(s) 196, 613
FaeI CATG 1 cut(s) 510
FaiI YATR 9 cut(s) 162, 280, 433, 435, 465, 476, 485, 489, 508
FaqI GGGAC 1 cut(s) 607
FatI CATG 1 cut(s) 506
FauI CCCGC 1 cut(s) 182
FspBI CTAG 1 cut(s) 312
GlaI GCGC 1 cut(s) 505
HaeIII GGCC 1 cut(s) 511
HhaI GCGC 1 cut(s) 506
Hin1II CATG 1 cut(s) 510
Hin6I GCGC 1 cut(s) 504
HinP1I GCGC 1 cut(s) 504
HincII GTYRAC 1 cut(s) 352
HindII GTYRAC 1 cut(s) 352
HinfI GANTC 3 cut(s) 219, 353, 580
Hpy166II GTNNAC 2 cut(s) 352, 451
Hpy188I TCNGA 1 cut(s) 423
Hpy188III TCNNGA 2 cut(s) 103, 312
Hpy8I GTNNAC 2 cut(s) 352, 451
HpyAV CCTTC 2 cut(s) 6, 406
HpyCH4III ACNGT 1 cut(s) 338
HpyCH4V TGCA 4 cut(s) 164, 245, 278, 591
HpyF10VI GCNNNNNNNGC 2 cut(s) 47, 424
HpyF3I CTNAG 1 cut(s) 576
Hsp92II CATG 1 cut(s) 510
HspAI GCGC 1 cut(s) 504
KflI GGGWCCC 1 cut(s) 621
LmnI GCTCC 2 cut(s) 415, 637
LpnPI CCDG 3 cut(s) 116, 160, 525
MaeI CTAG 1 cut(s) 312
MboII GAAGA 2 cut(s) 221, 564
MluCI AATT 6 cut(s) 45, 60, 156, 321, 367, 402
MlyI GAGTC 1 cut(s) 347
MnlI CCTC 5 cut(s) 37, 110, 124, 336, 595
MseI TTAA 3 cut(s) 114, 147, 566
MvnI CGCG 1 cut(s) 168
MwoI GCNNNNNNNGC 2 cut(s) 47, 424
NlaIII CATG 1 cut(s) 510
NlaIV GGNNCC 4 cut(s) 194, 453, 622, 623
PfeI GAWTC 2 cut(s) 219, 580
PflFI GACNNNGTC 1 cut(s) 440
PleI GAGTC 1 cut(s) 347
PpsI GAGTC 1 cut(s) 347
PpuMI RGGWCCY 1 cut(s) 621
PshBI ATTAAT 1 cut(s) 114
Psp5II RGGWCCY 1 cut(s) 621
PspN4I GGNNCC 4 cut(s) 194, 453, 622, 623
PspPI GGNCC 2 cut(s) 451, 621
PspPPI RGGWCCY 1 cut(s) 621
PsyI GACNNNGTC 1 cut(s) 440
RsaI GTAC 4 cut(s) 25, 295, 362, 387
RsaNI GTAC 4 cut(s) 24, 294, 361, 386
SaqAI TTAA 3 cut(s) 114, 147, 566
Sau96I GGNCC 2 cut(s) 451, 621
ScaI AGTACT 2 cut(s) 295, 387
SchI GAGTC 1 cut(s) 347
SfcI CTRYAG 1 cut(s) 513
SinI GGWCC 2 cut(s) 451, 621
SmlI CTYRAG 1 cut(s) 355
SmoI CTYRAG 1 cut(s) 355
Sse9I AATT 6 cut(s) 45, 60, 156, 321, 367, 402
SsiI CCGC 2 cut(s) 50, 189
SspMI CTAG 1 cut(s) 312
StyI CCWWGG 2 cut(s) 196, 613
TaaI ACNGT 1 cut(s) 338
TasI AATT 6 cut(s) 45, 60, 156, 321, 367, 402
TatI WGTACW 2 cut(s) 293, 385
TfiI GAWTC 2 cut(s) 219, 580
Tru1I TTAA 3 cut(s) 114, 147, 566
Tru9I TTAA 3 cut(s) 114, 147, 566
TspDTI ATGAA 3 cut(s) 72, 504, 512
Tth111I GACNNNGTC 1 cut(s) 440
VpaK11BI GGWCC 2 cut(s) 451, 621
VspI ATTAAT 1 cut(s) 114
XapI RAATTY 3 cut(s) 60, 156, 367
XbaI TCTAGA 1 cut(s) 311
XspI CTAG 1 cut(s) 312
ZrmI AGTACT 2 cut(s) 295, 387
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.