RLG00000033626

TMV resistance protein N-like

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr7
Physical Location & Seq
Reverse (-)
29755703 .. 29756017
315 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000033626

Sequence Viewer

Length: 315 bp
ATGTCCATTCGCAAACAACTCGACAAAGCAATTGAGGGATCAAAGGTTTGGGTTGTCATCGTTTCACCAAACTATGCTTCTTCAAAATGGTGCTTGAATGAGCTTTTGAAGATTCTTGAATGCAGAAAAGCATCTAAAGTGGGAAAGAAGAATGAAACTCTGATGAAGCCATTTGAAGAATATGAAGAACAAGCTCATACTCTGTTGAATGGAGACAAAACACATAAGGGGAAGGCTAGTTTACGGAACAAGGAAAACATCACTAATCATAATAAAAGGTTAGTCATCATCTTCAGTTTCTTGCATGTTAGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

105

Amino Acids

11.98

Weight (kDa)

9.66

Isoelectric Point (pI)

50.71

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
TIR_2 PF13676 2 - 43 4.7e-07 TIR domain
TIR PF01582 3 - 46 8.5e-15 TIR domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 46
AcuI CTGAAG 1 cut(s) 277
AgsI TTSAA 6 cut(s) 84, 97, 109, 119, 176, 208
AjuI GAANNNNNNNTTGG 2 cut(s) 61, 93
AluBI AGCT 2 cut(s) 103, 194
AluI AGCT 2 cut(s) 103, 194
Alw26I GTCTC 1 cut(s) 207
AlwI GGATC 1 cut(s) 46
AsuHPI GGTGA 1 cut(s) 57
BcgI CGANNNNNNTGC 1 cut(s) 35
BcoDI GTCTC 1 cut(s) 207
BfaI CTAG 1 cut(s) 237
BmsI GCATC 1 cut(s) 140
BsmAI GTCTC 1 cut(s) 207
BsmI GAATGC 1 cut(s) 125
Bsp143I GATC 1 cut(s) 38
BspPI GGATC 1 cut(s) 46
BssMI GATC 1 cut(s) 38
BstKTI GATC 1 cut(s) 41
BstMAI GTCTC 1 cut(s) 207
BstMBI GATC 1 cut(s) 38
BstNSI RCATGY 1 cut(s) 308
CviAII CATG 1 cut(s) 305
CviJI RGCY 4 cut(s) 103, 169, 194, 236
CviKI_1 RGCY 4 cut(s) 103, 169, 194, 236
DpnI GATC 1 cut(s) 40
DpnII GATC 1 cut(s) 38
Eco57I CTGAAG 1 cut(s) 277
FaeI CATG 1 cut(s) 308
FaiI YATR 6 cut(s) 75, 183, 198, 225, 270, 306
FatI CATG 1 cut(s) 304
FspBI CTAG 1 cut(s) 237
Hin1II CATG 1 cut(s) 308
HinfI GANTC 1 cut(s) 112
HphI GGTGA 1 cut(s) 57
Hpy166II GTNNAC 1 cut(s) 242
Hpy188I TCNGA 1 cut(s) 162
Hpy188III TCNNGA 1 cut(s) 116
Hpy8I GTNNAC 1 cut(s) 242
HpyAV CCTTC 1 cut(s) 226
HpyCH4V TGCA 2 cut(s) 123, 304
Hsp92II CATG 1 cut(s) 308
Kzo9I GATC 1 cut(s) 38
LweI GCATC 1 cut(s) 140
MaeI CTAG 1 cut(s) 237
MalI GATC 1 cut(s) 40
MboI GATC 1 cut(s) 38
MboII GAAGA 6 cut(s) 72, 121, 160, 188, 197, 283
MfeI CAATTG 1 cut(s) 30
MluCI AATT 1 cut(s) 30
MnlI CCTC 1 cut(s) 28
MseI TTAA 1 cut(s) 313
MunI CAATTG 1 cut(s) 30
Mva1269I GAATGC 1 cut(s) 125
NdeII GATC 1 cut(s) 38
NlaIII CATG 1 cut(s) 308
NspI RCATGY 1 cut(s) 308
PctI GAATGC 1 cut(s) 125
PfeI GAWTC 1 cut(s) 112
SaqAI TTAA 1 cut(s) 313
Sau3AI GATC 1 cut(s) 38
SetI ASST 4 cut(s) 48, 105, 196, 281
SfaNI GCATC 1 cut(s) 140
SgeI CNNG 6 cut(s) 32, 106, 128, 203, 249, 262
Sse9I AATT 1 cut(s) 30
SspMI CTAG 1 cut(s) 237
TaqI TCGA 1 cut(s) 21
TasI AATT 1 cut(s) 30
TfiI GAWTC 1 cut(s) 112
Tru1I TTAA 1 cut(s) 313
Tru9I TTAA 1 cut(s) 313
TspDTI ATGAA 3 cut(s) 168, 179, 198
TspGWI ACGGA 1 cut(s) 259
XceI RCATGY 1 cut(s) 308
XspI CTAG 1 cut(s) 237
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.