Rmu_co8330583.1_g000001

TMV resistance protein N-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8330583.1
OG0000885
Physical Location & Seq
Reverse (-)
2 .. 447
446 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8330583.1_g000001.1.cds

Sequence Viewer

Length: 367 bp
atgtccattcgcaaacaactcgacaaagcaattgagggatcaaaggtttgggttgtcatcatttcaccagattatgcttcttcaaaatggtgcttgaatgagcttttgaagattcttgaatgcagaaaagcatctaaagttggaaagaagaatgaaactttgatgaagccatttgaagaatatgaagaacaagctcgtactctggtgaatggagacaaaacacgtaaggggaaggctagtttgcggaacaaggaaaacatcactaatcataataaaacctgggaaatgggtgagttcagacttggcgttaactatggtggaaagtgggttggttccttttacataggtggtgagacagaagaaataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
LRR_3 LRR_8 NB-ARC TIR

Protein Analysis

122

Amino Acids

14.0

Weight (kDa)

9.21

Isoelectric Point (pI)

46.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 244
AclWI GGATC 1 cut(s) 46
AfaI GTAC 1 cut(s) 199
AflIII ACRYGT 1 cut(s) 221
AgsI TTSAA 5 cut(s) 84, 97, 109, 119, 176
AjnI CCWGG 1 cut(s) 278
AluBI AGCT 2 cut(s) 103, 194
AluI AGCT 2 cut(s) 103, 194
Alw26I GTCTC 2 cut(s) 207, 347
AlwI GGATC 1 cut(s) 46
AsuHPI GGTGA 4 cut(s) 57, 217, 302, 362
BcgI CGANNNNNNTGC 1 cut(s) 35
BciT130I CCWGG 1 cut(s) 280
BcoDI GTCTC 2 cut(s) 207, 347
BfaI CTAG 1 cut(s) 237
Bme1390I CCNGG 1 cut(s) 280
BmiI GGNNCC 1 cut(s) 334
BmrFI CCNGG 1 cut(s) 280
BmsI GCATC 1 cut(s) 140
BsaAI YACGTR 1 cut(s) 224
BsaJI CCNNGG 1 cut(s) 279
BseBI CCWGG 1 cut(s) 280
BseDI CCNNGG 1 cut(s) 279
BsmAI GTCTC 2 cut(s) 207, 347
BsmI GAATGC 1 cut(s) 125
Bsp143I GATC 1 cut(s) 38
BspACI CCGC 1 cut(s) 244
BspLI GGNNCC 1 cut(s) 334
BspPI GGATC 1 cut(s) 46
BssECI CCNNGG 1 cut(s) 279
BssMI GATC 1 cut(s) 38
Bst2UI CCWGG 1 cut(s) 280
BstBAI YACGTR 1 cut(s) 224
BstKTI GATC 1 cut(s) 41
BstMAI GTCTC 2 cut(s) 207, 347
BstMBI GATC 1 cut(s) 38
BstNI CCWGG 1 cut(s) 280
BstSCI CCNGG 1 cut(s) 278
Csp6I GTAC 1 cut(s) 198
CviJI RGCY 4 cut(s) 103, 169, 194, 236
CviKI_1 RGCY 4 cut(s) 103, 169, 194, 236
CviQI GTAC 1 cut(s) 198
DpnI GATC 1 cut(s) 40
DpnII GATC 1 cut(s) 38
EcoRII CCWGG 1 cut(s) 278
FaiI YATR 5 cut(s) 75, 183, 270, 315, 344
FspBI CTAG 1 cut(s) 237
HincII GTYRAC 1 cut(s) 310
HindII GTYRAC 1 cut(s) 310
HinfI GANTC 1 cut(s) 112
HpaI GTTAAC 1 cut(s) 310
HphI GGTGA 4 cut(s) 57, 217, 302, 362
Hpy166II GTNNAC 1 cut(s) 310
Hpy188I TCNGA 1 cut(s) 299
Hpy188III TCNNGA 1 cut(s) 116
Hpy8I GTNNAC 1 cut(s) 310
HpyAV CCTTC 1 cut(s) 226
HpyCH4IV ACGT 1 cut(s) 223
HpyCH4V TGCA 1 cut(s) 123
HpySE526I ACGT 1 cut(s) 223
KspAI GTTAAC 1 cut(s) 310
Kzo9I GATC 1 cut(s) 38
LpnPI CCDG 4 cut(s) 81, 188, 265, 292
LweI GCATC 1 cut(s) 140
MaeI CTAG 1 cut(s) 237
MaeII ACGT 1 cut(s) 223
MalI GATC 1 cut(s) 40
MboI GATC 1 cut(s) 38
MboII GAAGA 5 cut(s) 72, 121, 160, 188, 197
MfeI CAATTG 1 cut(s) 30
MluCI AATT 1 cut(s) 30
MmeI TCCRAC 1 cut(s) 121
MnlI CCTC 1 cut(s) 28
MseI TTAA 1 cut(s) 309
MspR9I CCNGG 1 cut(s) 280
MunI CAATTG 1 cut(s) 30
Mva1269I GAATGC 1 cut(s) 125
MvaI CCWGG 1 cut(s) 280
NdeII GATC 1 cut(s) 38
NlaIV GGNNCC 1 cut(s) 334
PctI GAATGC 1 cut(s) 125
PfeI GAWTC 1 cut(s) 112
Ppu21I YACGTR 1 cut(s) 224
Psp6I CCWGG 1 cut(s) 278
PspGI CCWGG 1 cut(s) 278
PspN4I GGNNCC 1 cut(s) 334
RsaI GTAC 1 cut(s) 199
RsaNI GTAC 1 cut(s) 198
SaqAI TTAA 1 cut(s) 309
Sau3AI GATC 1 cut(s) 38
ScrFI CCNGG 1 cut(s) 280
SetI ASST 6 cut(s) 48, 105, 196, 226, 281, 349
SfaNI GCATC 1 cut(s) 140
Sse9I AATT 1 cut(s) 30
SsiI CCGC 1 cut(s) 244
SspMI CTAG 1 cut(s) 237
StyD4I CCNGG 1 cut(s) 278
TaiI ACGT 1 cut(s) 226
TaqI TCGA 1 cut(s) 21
TasI AATT 1 cut(s) 30
TfiI GAWTC 1 cut(s) 112
Tru1I TTAA 1 cut(s) 309
Tru9I TTAA 1 cut(s) 309
TspDTI ATGAA 3 cut(s) 168, 179, 198
XspI CTAG 1 cut(s) 237
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.