Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0026350.1

Orthogroup ID

OG0000885

Physical Location & Seq

Genomic Coordinates Reverse (-)

2 .. 1135

Gene Structure 1134 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0026350.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 826 bp

atgggccatctacatgctgcattaattcaccgcggaatctccacctttagagatgacaaagatcttgagaaaggaaagtccattcccaaagaactcgacaaagcaattgagggatcaaaggtttgtgttgtcatcgtttcaccagactatgcttcttcaaaatggtgcttgaatgagcttttgaagattcttgaatgcgcttttgaagattcttccttaccgcaacatcatgaaaaagcccataatttggagagcagatacaaaataaataagtggaaggctagtttgcagaacaaggaagacatctctaatcataacaaaaggaaaatggttaagcttagcctcacggttaattatgatggagaatgggccagtcctgtttacactggtgataaaacaaaagaaatagtgatttcagatgacagtactcctgatgagcttctggatcaaatacatagttttgttggggtggatccaaaacacaatgagagcaatgctgatgataaccaaagaatttttattggtaagagcctttcttccagtacgggcttcaagaatccactgcggaatgcttgtgaaagaagaatgagtgaagttcgagttttggtgaattatgacggggagtgggtgaattctacatacgttggtggtcaaacgaaaggaatactgatttcagaggatattgcgtatcaaggacttgtggagagagtgtatggagttgtcggagttgatccacatgaatataagctgatattgaagaccagatatgaatcaaagtttcctactcaacccgtggagataatcaatgatgatgaccttgcattct

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

LRR_3 LRR_8 NB-ARC TIR

Protein Analysis

275

Amino Acids

31.14

Weight (kDa)

5.83

Isoelectric Point (pI)

38.96

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000885)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_2g26890 FvH4_2g26890 FvH4_2g26890 FvH4_3g20951 FvH4_3g20960 FvH4_3g20962
malus_domestica	MD03G1083300.v1.1 MD03G1083600.v1.1 MD08G1022000.v1.1 MD10G1261100.v1.1
prunus_persica	Prupe.1G183900_v2.0.a1 Prupe.1G184000_v2.0.a1
pyrus_communis	pycom03g06620 pycom05g26220 pycom10g21740
rosa_chinensis	RchiOBHm_Chr3g0475491 RchiOBHm_Chr5g0034591 RchiOBHm_Chr5g0035231 RchiOBHm_Chr5g0035371 RchiOBHm_Chr5g0035701 RchiOBHm_Chr5g0035711
rosa_laevigata	RLG00000005586 RLG00000022983 RLG00000033611 RLG00000033626 RLG00000033630 RLG00000033640 RLG00000033646 RLG00000033651 RLG00000033652
rosa_multiflora	Rmu_co8204696.1_g000001 Rmu_co8330583.1_g000001 Rmu_sc0001493.1_g000069 Rmu_sc0001493.1_g000077 Rmu_sc0001493.1_g000082 Rmu_sc0002460.1_g000096 Rmu_sc0002482.1_g000010 Rmu_sc0002482.1_g000012 Rmu_sc0002935.1_g000002 Rmu_sc0017377.1_g000001 Rmu_sc0026350.1_g000001 Rmu_sc0041591.1_g000001
rosa_roxburghii	Rroxscaffold_1G00042270 Rroxscaffold_1G00044790 Rroxscaffold_1G00044920 Rroxscaffold_1G00045020 Rroxscaffold_1G00045140 Rroxscaffold_1G00045740
rosa_rugosa	Rorug05G0146700 Rorug05G0146800 Rorug05G0150900 Rorug05G0151900
rosa_samantha	Rh5CG274900 Rh5CG276400 Rh5DG247800 Rh5DG266600 Rh5DG465900
rosa_wichuraiana	Rw0G005840 Rw5G021800 Rw5G021890 Rw5G022260 Rw5G022350 Rw5G022510 Rw5G022560 Rw5G023950 Rw5G023960

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	247
AccII	CGCG	1 cut(s)	33
AciI	CCGC	4 cut(s)	31, 33, 221, 565
AclWI	GGATC	5 cut(s)	121, 453, 467, 480, 725
AcsI	RAATTY	2 cut(s)	513, 631
AfaI	GTAC	2 cut(s)	427, 544
AfiI	CCNNNNNNNGG	1 cut(s)	247
AgsI	TTSAA	7 cut(s)	159, 172, 184, 194, 206, 553, 757
AluBI	AGCT	4 cut(s)	178, 337, 439, 748
AluI	AGCT	4 cut(s)	178, 337, 439, 748
AlwI	GGATC	5 cut(s)	121, 453, 467, 480, 725
AoxI	GGCC	2 cut(s)	4, 369
ApeKI	GCWGC	1 cut(s)	17
ApoI	RAATTY	2 cut(s)	513, 631
AseI	ATTAAT	1 cut(s)	23
AspLEI	GCGC	1 cut(s)	200
AspS9I	GGNCC	2 cut(s)	4, 369
AsuHPI	GGTGA	5 cut(s)	20, 132, 401, 619, 640
BamHI	GGATCC	1 cut(s)	472
BbsI	GAAGAC	2 cut(s)	306, 764
BbvI	GCAGC	1 cut(s)	4
BccI	CCATC	2 cut(s)	15, 353
BfaI	CTAG	1 cut(s)	282
BglII	AGATCT	1 cut(s)	61
BisI	GCNGC	1 cut(s)	18
BlpI	GCTNAGC	1 cut(s)	338
BlsI	GCNGC	1 cut(s)	19
BmcAI	AGTACT	1 cut(s)	427
BmgT120I	GGNCC	2 cut(s)	4, 369
BmiI	GGNNCC	1 cut(s)	474
BpiI	GAAGAC	2 cut(s)	306, 764
Bpu1102I	GCTNAGC	1 cut(s)	338
BpuEI	CTTGAG	1 cut(s)	86
BsaBI	GATNNNNATC	1 cut(s)	769
BsaJI	CCNNGG	2 cut(s)	31, 792
BsaXI	ACNNNNNCTCC	2 cut(s)	695, 725
Bsc4I	CCNNNNNNNGG	1 cut(s)	247
Bse1I	ACTGG	3 cut(s)	372, 391, 540
Bse3DI	GCAATG	1 cut(s)	499
Bse8I	GATNNNNATC	1 cut(s)	769
BseDI	CCNNGG	2 cut(s)	31, 792
BseJI	GATNNNNATC	1 cut(s)	769
BseLI	CCNNNNNNNGG	1 cut(s)	247
BseMI	GCAATG	1 cut(s)	499
BseNI	ACTGG	3 cut(s)	372, 391, 540
BseXI	GCAGC	1 cut(s)	4
Bsh1236I	CGCG	1 cut(s)	33
BshFI	GGCC	2 cut(s)	6, 371
BslI	CCNNNNNNNGG	1 cut(s)	247
BsmI	GAATGC	3 cut(s)	200, 574, 821
BsnI	GGCC	2 cut(s)	6, 371
Bsp143I	GATC	5 cut(s)	61, 113, 445, 472, 730
Bsp1720I	GCTNAGC	1 cut(s)	338
BspACI	CCGC	4 cut(s)	31, 33, 221, 565
BspANI	GGCC	2 cut(s)	6, 371
BspFNI	CGCG	1 cut(s)	33
BspHI	TCATGA	1 cut(s)	229
BspLI	GGNNCC	1 cut(s)	474
BspPI	GGATC	5 cut(s)	121, 453, 467, 480, 725
BsrDI	GCAATG	1 cut(s)	499
BsrI	ACTGG	3 cut(s)	372, 391, 540
BssECI	CCNNGG	2 cut(s)	31, 792
BssMI	GATC	5 cut(s)	61, 113, 445, 472, 730
Bst4CI	ACNGT	2 cut(s)	349, 425
BstDEI	CTNAG	1 cut(s)	338
BstDSI	CCRYGG	2 cut(s)	31, 792
BstFNI	CGCG	1 cut(s)	33
BstHHI	GCGC	1 cut(s)	200
BstKTI	GATC	5 cut(s)	64, 116, 448, 475, 733
BstMBI	GATC	5 cut(s)	61, 113, 445, 472, 730
BstNSI	RCATGY	1 cut(s)	17
BstUI	CGCG	1 cut(s)	33
BstV1I	GCAGC	1 cut(s)	4
BstV2I	GAAGAC	2 cut(s)	306, 764
BstX2I	RGATCY	2 cut(s)	61, 472
BstYI	RGATCY	2 cut(s)	61, 472
BsuRI	GGCC	2 cut(s)	6, 371
BtgI	CCRYGG	2 cut(s)	31, 792
BtsI	GCAGTG	1 cut(s)	560
BtsIMutI	CAGTG	2 cut(s)	384, 560
CciI	TCATGA	1 cut(s)	229
CfoI	GCGC	1 cut(s)	200
Cfr13I	GGNCC	2 cut(s)	4, 369
Cfr42I	CCGCGG	1 cut(s)	34
Csp6I	GTAC	2 cut(s)	426, 543
CviAII	CATG	3 cut(s)	14, 230, 737
CviQI	GTAC	2 cut(s)	426, 543
DdeI	CTNAG	1 cut(s)	338
DpnI	GATC	5 cut(s)	63, 115, 447, 474, 732
DpnII	GATC	5 cut(s)	61, 113, 445, 472, 730
EcoRI	GAATTC	1 cut(s)	631
FaeI	CATG	3 cut(s)	17, 233, 740
FatI	CATG	3 cut(s)	13, 229, 736
Fnu4HI	GCNGC	1 cut(s)	18
Fsp4HI	GCNGC	1 cut(s)	18
FspBI	CTAG	1 cut(s)	282
GlaI	GCGC	1 cut(s)	199
GluI	GCNGC	1 cut(s)	18
HaeIII	GGCC	2 cut(s)	6, 371
HhaI	GCGC	1 cut(s)	200
Hin1II	CATG	3 cut(s)	17, 233, 740
Hin6I	GCGC	1 cut(s)	198
HinP1I	GCGC	1 cut(s)	198
HindIII	AAGCTT	1 cut(s)	335
HinfI	GANTC	5 cut(s)	36, 187, 209, 556, 770
HphI	GGTGA	5 cut(s)	20, 132, 401, 619, 640
Hpy166II	GTNNAC	1 cut(s)	382
Hpy188I	TCNGA	3 cut(s)	418, 676, 725
Hpy188III	TCNNGA	6 cut(s)	65, 191, 230, 431, 443, 553
Hpy8I	GTNNAC	1 cut(s)	382
HpyAV	CCTTC	1 cut(s)	271
HpyCH4III	ACNGT	2 cut(s)	349, 425
HpyCH4IV	ACGT	1 cut(s)	642
HpyCH4V	TGCA	3 cut(s)	20, 289, 821
HpyF3I	CTNAG	1 cut(s)	338
HpySE526I	ACGT	1 cut(s)	642
Hsp92II	CATG	3 cut(s)	17, 233, 740
HspAI	GCGC	1 cut(s)	198
KspI	CCGCGG	1 cut(s)	34
Kzo9I	GATC	5 cut(s)	61, 113, 445, 472, 730
LpnPI	CCDG	8 cut(s)	156, 372, 385, 390, 428, 444, 553, 775
Lsp1109I	GCAGC	1 cut(s)	4
MaeI	CTAG	1 cut(s)	282
MaeII	ACGT	1 cut(s)	642
MalI	GATC	5 cut(s)	63, 115, 447, 474, 732
MboI	GATC	5 cut(s)	61, 113, 445, 472, 730
MboII	GAAGA	8 cut(s)	147, 196, 204, 218, 311, 528, 594, 769
MfeI	CAATTG	1 cut(s)	105
MflI	RGATCY	2 cut(s)	61, 472
MluCI	AATT	7 cut(s)	24, 105, 244, 352, 513, 610, 631
MmeI	TCCRAC	1 cut(s)	703
MnlI	CCTC	3 cut(s)	103, 353, 670
MseI	TTAA	3 cut(s)	23, 333, 351
MslI	CAYNNNNRTG	1 cut(s)	12
MspA1I	CMGCKG	1 cut(s)	33
MunI	CAATTG	1 cut(s)	105
Mva1269I	GAATGC	3 cut(s)	200, 574, 821
MvnI	CGCG	1 cut(s)	33
NdeII	GATC	5 cut(s)	61, 113, 445, 472, 730
NlaIII	CATG	3 cut(s)	17, 233, 740
NlaIV	GGNNCC	1 cut(s)	474
NspI	RCATGY	1 cut(s)	17
PagI	TCATGA	1 cut(s)	229
PctI	GAATGC	3 cut(s)	200, 574, 821
PfeI	GAWTC	5 cut(s)	36, 187, 209, 556, 770
PflMI	CCANNNNNTGG	1 cut(s)	247
PkrI	GCNGC	1 cut(s)	19
PshBI	ATTAAT	1 cut(s)	23
PspN4I	GGNNCC	1 cut(s)	474
PspPI	GGNCC	2 cut(s)	4, 369
PsuI	RGATCY	2 cut(s)	61, 472
RsaI	GTAC	2 cut(s)	427, 544
RsaNI	GTAC	2 cut(s)	426, 543
RseI	CAYNNNNRTG	1 cut(s)	12
SacII	CCGCGG	1 cut(s)	34
SaqAI	TTAA	3 cut(s)	23, 333, 351
SatI	GCNGC	1 cut(s)	18
Sau3AI	GATC	5 cut(s)	61, 113, 445, 472, 730
Sau96I	GGNCC	2 cut(s)	4, 369
ScaI	AGTACT	1 cut(s)	427
SetI	ASST	8 cut(s)	47, 123, 180, 339, 441, 645, 750, 819
Sfr303I	CCGCGG	1 cut(s)	34
SgrBI	CCGCGG	1 cut(s)	34
SmiMI	CAYNNNNRTG	1 cut(s)	12
SmlI	CTYRAG	1 cut(s)	65
SmoI	CTYRAG	1 cut(s)	65
Sse9I	AATT	7 cut(s)	24, 105, 244, 352, 513, 610, 631
SsiI	CCGC	4 cut(s)	31, 33, 221, 565
SspMI	CTAG	1 cut(s)	282
TaaI	ACNGT	2 cut(s)	349, 425
TaiI	ACGT	1 cut(s)	645
TaqI	TCGA	2 cut(s)	96, 598
TasI	AATT	7 cut(s)	24, 105, 244, 352, 513, 610, 631
TatI	WGTACW	1 cut(s)	425
TfiI	GAWTC	5 cut(s)	36, 187, 209, 556, 770
Tru1I	TTAA	3 cut(s)	23, 333, 351
Tru9I	TTAA	3 cut(s)	23, 333, 351
TscAI	CASTG	2 cut(s)	391, 567
TseI	GCWGC	1 cut(s)	17
TspDTI	ATGAA	3 cut(s)	246, 753, 783
TspRI	CASTG	2 cut(s)	391, 567
Van91I	CCANNNNNTGG	1 cut(s)	247
VspI	ATTAAT	1 cut(s)	23
XapI	RAATTY	2 cut(s)	513, 631
XceI	RCATGY	1 cut(s)	17
XspI	CTAG	1 cut(s)	282
ZrmI	AGTACT	1 cut(s)	427

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.