Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002482.1

Orthogroup ID

OG0000885

Physical Location & Seq

Genomic Coordinates Forward (+)

49400 .. 50342

Gene Structure 943 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002482.1_g000012.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 864 bp

ctgtataggcccgaagcaaaactcattcgagaagttgttgatgagatatggaggaaattgtattcttctttttcaaaacctgccattacaaatgtgccatcaacaccttcttggtcctcttcttgtcgacagaagcatgatgtttttctaagctttagagggaaggatacccgcttgaattttttggaccatctatatgatgcattaattcagcaaaaaatttccacctttagggatgacaaagatcttcagaaaggactgtccattcggaaacaactcgacaatgcaattgagggatcaaaggtttgggttgtcattgtttcaccagagtatgcttcttcaaaatggtgcttggatgagctttccaagattcttgaatgtagaaaagcatctaaagtcgaaaataagaatcaaactttggtgaaggcagttgcagaacatgaagaacaagctcatactttggtgaatggagacaaaacacacaaggggaaggctagtttgcgtaaggaaaccatcagtaatcataataaaagaaaaatgggtgacgtcagacttggggttaattatggcggaaagtgggttggttctgtttacataggtggcagcaggacagaagaaatagtggtttcagaagacattacttataatgagcttctagatcaaatgtattatatagttggagtggatccaagtgaaaatgagatcaagatcagcacgatcgatgaattaaaatcaccagcttatcctgtggagataatcgatgatgatgacctaaaaacttttattgatcagagccgttcgtccaatatgcactcaaagcatccattgcagaatgtctctgggaggtatactctcgacttttag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

LRR_3 LRR_8 NB-ARC TIR

Protein Analysis

287

Amino Acids

32.8

Weight (kDa)

7.24

Isoelectric Point (pI)

44.9

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000885)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_2g26890 FvH4_2g26890 FvH4_2g26890 FvH4_3g20951 FvH4_3g20960 FvH4_3g20962
malus_domestica	MD03G1083300.v1.1 MD03G1083600.v1.1 MD08G1022000.v1.1 MD10G1261100.v1.1
prunus_persica	Prupe.1G183900_v2.0.a1 Prupe.1G184000_v2.0.a1
pyrus_communis	pycom03g06620 pycom05g26220 pycom10g21740
rosa_chinensis	RchiOBHm_Chr3g0475491 RchiOBHm_Chr5g0034591 RchiOBHm_Chr5g0035231 RchiOBHm_Chr5g0035371 RchiOBHm_Chr5g0035701 RchiOBHm_Chr5g0035711
rosa_laevigata	RLG00000005586 RLG00000022983 RLG00000033611 RLG00000033626 RLG00000033630 RLG00000033640 RLG00000033646 RLG00000033651 RLG00000033652
rosa_multiflora	Rmu_co8204696.1_g000001 Rmu_co8330583.1_g000001 Rmu_sc0001493.1_g000069 Rmu_sc0001493.1_g000077 Rmu_sc0001493.1_g000082 Rmu_sc0002460.1_g000096 Rmu_sc0002482.1_g000010 Rmu_sc0002482.1_g000012 Rmu_sc0002935.1_g000002 Rmu_sc0017377.1_g000001 Rmu_sc0026350.1_g000001 Rmu_sc0041591.1_g000001
rosa_roxburghii	Rroxscaffold_1G00042270 Rroxscaffold_1G00044790 Rroxscaffold_1G00044920 Rroxscaffold_1G00045020 Rroxscaffold_1G00045140 Rroxscaffold_1G00045740
rosa_rugosa	Rorug05G0146700 Rorug05G0146800 Rorug05G0150900 Rorug05G0151900
rosa_samantha	Rh5CG274900 Rh5CG276400 Rh5DG247800 Rh5DG266600 Rh5DG465900
rosa_wichuraiana	Rw0G005840 Rw5G021800 Rw5G021890 Rw5G022260 Rw5G022350 Rw5G022510 Rw5G022560 Rw5G023950 Rw5G023960

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	645
AatII	GACGTC	1 cut(s)	549
Acc36I	ACCTGC	1 cut(s)	88
AccI	GTMKAC	2 cut(s)	127, 848
AciI	CCGC	2 cut(s)	172, 570
AclWI	GGATC	3 cut(s)	304, 680, 693
AcsI	RAATTY	2 cut(s)	178, 219
AcuI	CTGAAG	1 cut(s)	233
AcyI	GRCGYC	1 cut(s)	546
AfiI	CCNNNNNNNGG	1 cut(s)	231
AgsI	TTSAA	4 cut(s)	75, 178, 342, 377
AjuI	GAANNNNNNNTTGG	2 cut(s)	401, 433
AluBI	AGCT	5 cut(s)	153, 361, 452, 652, 740
AluI	AGCT	5 cut(s)	153, 361, 452, 652, 740
Alw26I	GTCTC	2 cut(s)	465, 841
AlwI	GGATC	3 cut(s)	304, 680, 693
AoxI	GGCC	1 cut(s)	8
ApeKI	GCWGC	1 cut(s)	603
ApoI	RAATTY	2 cut(s)	178, 219
ArsI	GACNNNNNNTTYG	2 cut(s)	249, 281
AseI	ATTAAT	1 cut(s)	206
AspS9I	GGNCC	3 cut(s)	9, 114, 187
AsuHPI	GGTGA	5 cut(s)	315, 433, 475, 554, 726
AvaII	GGWCC	2 cut(s)	114, 187
BamHI	GGATCC	1 cut(s)	685
BbsI	GAAGAC	1 cut(s)	639
BbvI	GCAGC	1 cut(s)	615
BccI	CCATC	3 cut(s)	106, 198, 521
BceAI	ACGGC	1 cut(s)	780
BciVI	GTATCC	1 cut(s)	160
BclI	TGATCA	1 cut(s)	787
BcoDI	GTCTC	2 cut(s)	465, 841
BfaI	CTAG	2 cut(s)	495, 656
BfuAI	ACCTGC	1 cut(s)	88
BfuI	GTATCC	1 cut(s)	160
BglII	AGATCT	1 cut(s)	244
BisI	GCNGC	1 cut(s)	604
BlsI	GCNGC	1 cut(s)	605
Bme18I	GGWCC	2 cut(s)	114, 187
BmgT120I	GGNCC	3 cut(s)	9, 114, 187
BmiI	GGNNCC	1 cut(s)	687
BmsI	GCATC	3 cut(s)	190, 398, 829
BpiI	GAAGAC	1 cut(s)	639
BplI	GAGNNNNNCTC	1 cut(s)	835
Bsa29I	ATCGAT	2 cut(s)	720, 759
BsaBI	GATNNNNATC	1 cut(s)	707
BsaHI	GRCGYC	1 cut(s)	546
Bsc4I	CCNNNNNNNGG	1 cut(s)	231
Bse3DI	GCAATG	1 cut(s)	824
Bse8I	GATNNNNATC	1 cut(s)	707
BseCI	ATCGAT	2 cut(s)	720, 759
BseGI	GGATG	3 cut(s)	241, 361, 820
BseJI	GATNNNNATC	1 cut(s)	707
BseLI	CCNNNNNNNGG	1 cut(s)	231
BseMI	GCAATG	1 cut(s)	824
BseXI	GCAGC	1 cut(s)	615
Bsh1285I	CGRYCG	1 cut(s)	720
BshFI	GGCC	1 cut(s)	10
BshVI	ATCGAT	2 cut(s)	720, 759
BsiEI	CGRYCG	1 cut(s)	720
BslI	CCNNNNNNNGG	1 cut(s)	231
BsmAI	GTCTC	2 cut(s)	465, 841
BsnI	GGCC	1 cut(s)	10
Bsp143I	GATC	8 cut(s)	244, 296, 658, 685, 702, 708, 717, 787
BspACI	CCGC	2 cut(s)	172, 570
BspANI	GGCC	1 cut(s)	10
BspDI	ATCGAT	2 cut(s)	720, 759
BspLI	GGNNCC	1 cut(s)	687
BspMI	ACCTGC	1 cut(s)	88
BspPI	GGATC	3 cut(s)	304, 680, 693
BsrDI	GCAATG	1 cut(s)	824
BssMI	GATC	8 cut(s)	244, 296, 658, 685, 702, 708, 717, 787
BssNAI	GTATAC	1 cut(s)	849
BssNI	GRCGYC	1 cut(s)	546
Bst1107I	GTATAC	1 cut(s)	849
Bst4CI	ACNGT	1 cut(s)	261
Bst6I	CTCTTC	1 cut(s)	124
BstACI	GRCGYC	1 cut(s)	546
BstAPI	GCANNNNNTGC	1 cut(s)	826
BstDEI	CTNAG	1 cut(s)	149
BstF5I	GGATG	3 cut(s)	241, 361, 820
BstKTI	GATC	8 cut(s)	247, 299, 661, 688, 705, 711, 720, 790
BstMAI	GTCTC	2 cut(s)	465, 841
BstMBI	GATC	8 cut(s)	244, 296, 658, 685, 702, 708, 717, 787
BstMCI	CGRYCG	1 cut(s)	720
BstMWI	GCNNNNNNNGC	2 cut(s)	817, 826
BstV1I	GCAGC	1 cut(s)	615
BstV2I	GAAGAC	1 cut(s)	639
BstX2I	RGATCY	2 cut(s)	244, 685
BstYI	RGATCY	2 cut(s)	244, 685
BstZ17I	GTATAC	1 cut(s)	849
Bsu15I	ATCGAT	2 cut(s)	720, 759
BsuI	GTATCC	1 cut(s)	160
BsuRI	GGCC	1 cut(s)	10
BsuTUI	ATCGAT	2 cut(s)	720, 759
BtsCI	GGATG	3 cut(s)	241, 361, 820
BveI	ACCTGC	1 cut(s)	88
Cfr13I	GGNCC	3 cut(s)	9, 114, 187
ClaI	ATCGAT	2 cut(s)	720, 759
CviAII	CATG	2 cut(s)	137, 440
CviJI	RGCY	8 cut(s)	10, 153, 361, 452, 494, 652, 740, 795
CviKI_1	RGCY	8 cut(s)	10, 153, 361, 452, 494, 652, 740, 795
DdeI	CTNAG	1 cut(s)	149
DpnI	GATC	8 cut(s)	246, 298, 660, 687, 704, 710, 719, 789
DpnII	GATC	8 cut(s)	244, 296, 658, 685, 702, 708, 717, 787
Eam1104I	CTCTTC	1 cut(s)	124
EarI	CTCTTC	1 cut(s)	124
EciI	GGCGGA	1 cut(s)	585
Eco47I	GGWCC	2 cut(s)	114, 187
Eco57I	CTGAAG	1 cut(s)	233
EcoT22I	ATGCAT	1 cut(s)	205
FaeI	CATG	2 cut(s)	140, 443
FatI	CATG	2 cut(s)	136, 439
FauI	CCCGC	1 cut(s)	179
FbaI	TGATCA	1 cut(s)	787
FblI	GTMKAC	2 cut(s)	127, 848
Fnu4HI	GCNGC	1 cut(s)	604
FokI	GGATG	3 cut(s)	248, 368, 807
Fsp4HI	GCNGC	1 cut(s)	604
FspBI	CTAG	2 cut(s)	495, 656
GluI	GCNGC	1 cut(s)	604
HaeIII	GGCC	1 cut(s)	10
Hin1I	GRCGYC	1 cut(s)	546
Hin1II	CATG	2 cut(s)	140, 443
HincII	GTYRAC	1 cut(s)	128
HindII	GTYRAC	1 cut(s)	128
HindIII	AAGCTT	1 cut(s)	151
HinfI	GANTC	2 cut(s)	370, 409
HphI	GGTGA	5 cut(s)	315, 433, 475, 554, 726
Hpy166II	GTNNAC	3 cut(s)	128, 592, 849
Hpy188I	TCNGA	5 cut(s)	252, 270, 551, 631, 792
Hpy188III	TCNNGA	5 cut(s)	29, 374, 656, 706, 854
Hpy8I	GTNNAC	3 cut(s)	128, 592, 849
HpyAV	CCTTC	4 cut(s)	117, 157, 418, 484
HpyCH4III	ACNGT	1 cut(s)	261
HpyCH4IV	ACGT	1 cut(s)	546
HpyCH4V	TGCA	5 cut(s)	203, 287, 434, 811, 829
HpyF10VI	GCNNNNNNNGC	2 cut(s)	817, 826
HpyF3I	CTNAG	1 cut(s)	149
HpySE526I	ACGT	1 cut(s)	546
Hsp92I	GRCGYC	1 cut(s)	546
Hsp92II	CATG	2 cut(s)	140, 443
Ksp22I	TGATCA	1 cut(s)	787
Kzo9I	GATC	8 cut(s)	244, 296, 658, 685, 702, 708, 717, 787
LpnPI	CCDG	6 cut(s)	93, 339, 592, 750, 759, 825
Lsp1109I	GCAGC	1 cut(s)	615
LweI	GCATC	3 cut(s)	190, 398, 829
MaeI	CTAG	2 cut(s)	495, 656
MaeII	ACGT	1 cut(s)	546
MaeIII	GTNAC	1 cut(s)	542
MalI	GATC	8 cut(s)	246, 298, 660, 687, 704, 710, 719, 789
MboI	GATC	8 cut(s)	244, 296, 658, 685, 702, 708, 717, 787
MboII	GAAGA	7 cut(s)	57, 111, 239, 330, 455, 626, 644
MfeI	CAATTG	1 cut(s)	288
MflI	RGATCY	2 cut(s)	244, 685
MluCI	AATT	7 cut(s)	56, 178, 207, 219, 288, 562, 725
MmeI	TCCRAC	1 cut(s)	658
MnlI	CCTC	5 cut(s)	45, 127, 152, 286, 837
Mph1103I	ATGCAT	1 cut(s)	205
MseI	TTAA	3 cut(s)	206, 561, 728
MslI	CAYNNNNRTG	1 cut(s)	195
MunI	CAATTG	1 cut(s)	288
MwoI	GCNNNNNNNGC	2 cut(s)	817, 826
NdeII	GATC	8 cut(s)	244, 296, 658, 685, 702, 708, 717, 787
NlaIII	CATG	2 cut(s)	140, 443
NlaIV	GGNNCC	1 cut(s)	687
NmuCI	GTSAC	1 cut(s)	542
NsiI	ATGCAT	1 cut(s)	205
PfeI	GAWTC	2 cut(s)	370, 409
PkrI	GCNGC	1 cut(s)	605
Ple19I	CGATCG	1 cut(s)	720
PshBI	ATTAAT	1 cut(s)	206
PsiI	TTATAA	1 cut(s)	645
PspN4I	GGNNCC	1 cut(s)	687
PspPI	GGNCC	3 cut(s)	9, 114, 187
PsuI	RGATCY	2 cut(s)	244, 685
PvuI	CGATCG	1 cut(s)	720
RseI	CAYNNNNRTG	1 cut(s)	195
SalI	GTCGAC	1 cut(s)	126
SaqAI	TTAA	3 cut(s)	206, 561, 728
SatI	GCNGC	1 cut(s)	604
Sau3AI	GATC	8 cut(s)	244, 296, 658, 685, 702, 708, 717, 787
Sau96I	GGNCC	3 cut(s)	9, 114, 187
SfaNI	GCATC	3 cut(s)	190, 398, 829
SinI	GGWCC	2 cut(s)	114, 187
SmiMI	CAYNNNNRTG	1 cut(s)	195
Sse9I	AATT	7 cut(s)	56, 178, 207, 219, 288, 562, 725
SsiI	CCGC	2 cut(s)	172, 570
SspMI	CTAG	2 cut(s)	495, 656
TaaI	ACNGT	1 cut(s)	261
TaiI	ACGT	1 cut(s)	549
TaqI	TCGA	7 cut(s)	28, 127, 279, 399, 720, 759, 855
TasI	AATT	7 cut(s)	56, 178, 207, 219, 288, 562, 725
TfiI	GAWTC	2 cut(s)	370, 409
Tru1I	TTAA	3 cut(s)	206, 561, 728
Tru9I	TTAA	3 cut(s)	206, 561, 728
TseFI	GTSAC	1 cut(s)	542
TseI	GCWGC	1 cut(s)	603
Tsp45I	GTSAC	1 cut(s)	542
TspDTI	ATGAA	2 cut(s)	456, 738
VpaK11BI	GGWCC	2 cut(s)	114, 187
VspI	ATTAAT	1 cut(s)	206
XapI	RAATTY	2 cut(s)	178, 219
XbaI	TCTAGA	1 cut(s)	655
XmiI	GTMKAC	2 cut(s)	127, 848
XspI	CTAG	2 cut(s)	495, 656
ZraI	GACGTC	1 cut(s)	547
Zsp2I	ATGCAT	1 cut(s)	205

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.