Rmu_co8204696.1_g000001

TMV resistance protein N-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8204696.1
Physical Location & Seq
Reverse (-)
355 .. 696
342 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8204696.1_g000001.1.cds

Sequence Viewer

Length: 342 bp
atgggtgagttcagacttggcgttacctatggcggaaagtgggttgattctgtttacataggtggtaggacagaagaaatagtggtttcagaagacattacttatagtgagcttctagatcaactgtatcatattgttggagtacatccaactgaaaatgagatcaagatcagtacgatcgatgaatcaaaatcaccggcttatcctgtggagataatcaatgatgatgacctcaaaaattttattgatcaaagcctttcttccgacgtgtacttgaagcatccattgcgaaattcctctaggaggtactctgaacttttaattttgggatacttttggtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

113

Amino Acids

12.99

Weight (kDa)

4.61

Isoelectric Point (pI)

50.82

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 33
AcsI RAATTY 2 cut(s) 238, 292
AfaI GTAC 4 cut(s) 144, 175, 272, 308
AfiI CCNNNNNNNGG 1 cut(s) 303
AflIII ACRYGT 1 cut(s) 267
AgsI TTSAA 1 cut(s) 277
AjiI CACGTC 1 cut(s) 268
AluBI AGCT 1 cut(s) 112
AluI AGCT 1 cut(s) 112
ApoI RAATTY 2 cut(s) 238, 292
AsuHPI GGTGA 2 cut(s) 17, 186
BbsI GAAGAC 1 cut(s) 99
BciVI GTATCC 1 cut(s) 323
BclI TGATCA 1 cut(s) 247
BfaI CTAG 2 cut(s) 116, 300
BfuI GTATCC 1 cut(s) 323
BmgBI CACGTC 1 cut(s) 268
BmsI GCATC 1 cut(s) 289
BpiI GAAGAC 1 cut(s) 99
Bsa29I ATCGAT 1 cut(s) 180
BsaBI GATNNNNATC 1 cut(s) 167
Bsc4I CCNNNNNNNGG 1 cut(s) 303
Bse118I RCCGGY 1 cut(s) 196
Bse3DI GCAATG 1 cut(s) 284
Bse8I GATNNNNATC 1 cut(s) 167
BseCI ATCGAT 1 cut(s) 180
BseGI GGATG 2 cut(s) 145, 280
BseJI GATNNNNATC 1 cut(s) 167
BseLI CCNNNNNNNGG 1 cut(s) 303
BseMI GCAATG 1 cut(s) 284
Bsh1285I CGRYCG 1 cut(s) 180
BshVI ATCGAT 1 cut(s) 180
BsiEI CGRYCG 1 cut(s) 180
BsiSI CCGG 1 cut(s) 197
BslI CCNNNNNNNGG 1 cut(s) 303
Bsp143I GATC 5 cut(s) 118, 162, 168, 177, 247
BspACI CCGC 1 cut(s) 33
BspDI ATCGAT 1 cut(s) 180
BsrDI GCAATG 1 cut(s) 284
BsrFI RCCGGY 1 cut(s) 196
BssAI RCCGGY 1 cut(s) 196
BssMI GATC 5 cut(s) 118, 162, 168, 177, 247
Bst4CI ACNGT 1 cut(s) 126
BstAPI GCANNNNNTGC 1 cut(s) 286
BstENI CCTNNNNNAGG 1 cut(s) 301
BstF5I GGATG 2 cut(s) 145, 280
BstKTI GATC 5 cut(s) 121, 165, 171, 180, 250
BstMBI GATC 5 cut(s) 118, 162, 168, 177, 247
BstMCI CGRYCG 1 cut(s) 180
BstMWI GCNNNNNNNGC 1 cut(s) 286
BstV2I GAAGAC 1 cut(s) 99
Bsu15I ATCGAT 1 cut(s) 180
BsuI GTATCC 1 cut(s) 323
BsuTUI ATCGAT 1 cut(s) 180
BtrI CACGTC 1 cut(s) 268
BtsCI GGATG 2 cut(s) 145, 280
Cfr10I RCCGGY 1 cut(s) 196
ClaI ATCGAT 1 cut(s) 180
Csp6I GTAC 4 cut(s) 143, 174, 271, 307
CviJI RGCY 3 cut(s) 112, 200, 255
CviKI_1 RGCY 3 cut(s) 112, 200, 255
CviQI GTAC 4 cut(s) 143, 174, 271, 307
DpnI GATC 5 cut(s) 120, 164, 170, 179, 249
DpnII GATC 5 cut(s) 118, 162, 168, 177, 247
EciI GGCGGA 1 cut(s) 48
EcoNI CCTNNNNNAGG 1 cut(s) 301
FaiI YATR 4 cut(s) 30, 59, 105, 132
FalI AAGNNNNNCTT 2 cut(s) 244, 276
FbaI TGATCA 1 cut(s) 247
FokI GGATG 2 cut(s) 132, 267
FspBI CTAG 2 cut(s) 116, 300
HapII CCGG 1 cut(s) 197
HinfI GANTC 2 cut(s) 47, 185
HpaII CCGG 1 cut(s) 197
HphI GGTGA 2 cut(s) 17, 186
Hpy166II GTNNAC 2 cut(s) 55, 271
Hpy188I TCNGA 4 cut(s) 14, 91, 265, 313
Hpy188III TCNNGA 2 cut(s) 116, 166
Hpy8I GTNNAC 2 cut(s) 55, 271
Hpy99I CGWCG 1 cut(s) 269
HpyCH4III ACNGT 1 cut(s) 126
HpyCH4IV ACGT 1 cut(s) 267
HpyF10VI GCNNNNNNNGC 1 cut(s) 286
HpySE526I ACGT 1 cut(s) 267
Ksp22I TGATCA 1 cut(s) 247
Kzo9I GATC 5 cut(s) 118, 162, 168, 177, 247
LpnPI CCDG 2 cut(s) 210, 219
LweI GCATC 1 cut(s) 289
MaeI CTAG 2 cut(s) 116, 300
MaeII ACGT 1 cut(s) 267
MaeIII GTNAC 1 cut(s) 22
MalI GATC 5 cut(s) 120, 164, 170, 179, 249
MboI GATC 5 cut(s) 118, 162, 168, 177, 247
MboII GAAGA 3 cut(s) 86, 104, 252
MluCI AATT 3 cut(s) 238, 292, 321
MmeI TCCRAC 3 cut(s) 118, 173, 288
MnlI CCTC 3 cut(s) 242, 297, 307
MseI TTAA 1 cut(s) 320
MspI CCGG 1 cut(s) 197
MwoI GCNNNNNNNGC 1 cut(s) 286
NdeII GATC 5 cut(s) 118, 162, 168, 177, 247
PfeI GAWTC 2 cut(s) 47, 185
Ple19I CGATCG 1 cut(s) 180
PvuI CGATCG 1 cut(s) 180
RsaI GTAC 4 cut(s) 144, 175, 272, 308
RsaNI GTAC 4 cut(s) 143, 174, 271, 307
SaqAI TTAA 1 cut(s) 320
Sau3AI GATC 5 cut(s) 118, 162, 168, 177, 247
SetI ASST 6 cut(s) 29, 64, 114, 234, 270, 308
SfaNI GCATC 1 cut(s) 289
SgeI CNNG 8 cut(s) 29, 128, 178, 209, 218, 280, 286, 312
Sse9I AATT 3 cut(s) 238, 292, 321
SsiI CCGC 1 cut(s) 33
SspMI CTAG 2 cut(s) 116, 300
TaaI ACNGT 1 cut(s) 126
TaiI ACGT 1 cut(s) 270
TaqI TCGA 1 cut(s) 180
TasI AATT 3 cut(s) 238, 292, 321
TatI WGTACW 2 cut(s) 142, 270
TfiI GAWTC 2 cut(s) 47, 185
Tru1I TTAA 1 cut(s) 320
Tru9I TTAA 1 cut(s) 320
TspDTI ATGAA 1 cut(s) 198
XagI CCTNNNNNAGG 1 cut(s) 301
XapI RAATTY 2 cut(s) 238, 292
XbaI TCTAGA 1 cut(s) 115
XspI CTAG 2 cut(s) 116, 300
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.