pycom03g02980

transposition, RNA-mediated

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr3
Physical Location & Seq
Forward (+)
2326997 .. 2327191
195 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom03g02980.1

Sequence Viewer

Length: 195 bp
ATGTCGTTGAGGAAGAAGCTTGGACATGCCACCATACTAAGTGTTGAAGAAGTTAAAGGAAAAACCGACGAGAAAAAGCCAACTACTTATCCAATAACTTGGACATCAAGCTATATCCAATATCCACAACATCCTCCACACCATCACATAGTTCATGATCAATATCCACAAGAAACCAATTGTTCTATTATGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

65

Amino Acids

7.46

Weight (kDa)

7.94

Isoelectric Point (pI)

38.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000276)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G05030 AT4G05030
fragaria_vesca FvH4_3g24080 FvH4_3g24080 FvH4_3g24100 FvH4_3g24100 FvH4_3g42050 FvH4_3g42060 FvH4_3g42070 FvH4_3g42071 FvH4_3g42080 FvH4_3g42090 FvH4_3g42100 FvH4_3g42110
malus_domestica MD03G1038100.v1.1 MD03G1038400.v1.1 MD03G1038600.v1.1 MD03G1038900.v1.1 MD03G1039000.v1.1 MD03G1039100.v1.1 MD03G1188500.v1.1 MD10G1233100.v1.1 MD10G1233300.v1.1 MD10G1341200.v1.1 MD11G1039200.v1.1 MD11G1039300.v1.1 MD11G1204400.v1.1 MD11G1204600.v1.1
prunus_persica Prupe.2G123900_v2.0.a1 Prupe.4G001900_v2.0.a1 Prupe.4G234700_v2.0.a1 Prupe.4G234800_v2.0.a1 Prupe.6G025900_v2.0.a1 Prupe.6G030200_v2.0.a1 Prupe.6G030300_v2.0.a1 Prupe.6G030400_v2.0.a1 Prupe.6G030600_v2.0.a1 Prupe.6G030900_v2.0.a1 Prupe.6G031000_v2.0.a1 Prupe.6G031100_v2.0.a1 Prupe.6G031100_v2.0.a1
pyrus_communis pycom03g02940 pycom03g02950 pycom03g02980 pycom03g02990 pycom03g03010 pycom11g03310 pycom11g03320
rosa_chinensis RchiOBHm_Chr3g0484311 RchiOBHm_Chr5g0000231 RchiOBHm_Chr5g0042661 RchiOBHm_Chr5g0042671 RchiOBHm_Chr5g0075281 RchiOBHm_Chr5g0075291 RchiOBHm_Chr5g0075321 RchiOBHm_Chr5g0075331
rosa_laevigata RLG00000034149 RLG00000036545 RLG00000036546 RLG00000036547 RLG00000036548 RLG00000036549 RLG00000036550
rosa_multiflora Rmu_sc0000295.1_g000011 Rmu_sc0000770.1_g000041 Rmu_sc0000770.1_g000049 Rmu_sc0002564.1_g000002 Rmu_sc0002564.1_g000003 Rmu_sc0002564.1_g000016
rosa_roxburghii Rroxscaffold_1G00006200 Rroxscaffold_1G00006210 Rroxscaffold_1G00006220 Rroxscaffold_1G00006250 Rroxscaffold_1G00006270 Rroxscaffold_1G00037900 Rroxscaffold_1G00037980 Rroxscaffold_6G00397790
rosa_rugosa Rorug03G0210600 Rorug05G0203800 Rorug05G0203900 Rorug05G0438100 Rorug05G0438200 Rorug05G0438700 Rorug05G0438900 Rorug05G0438900
rosa_samantha Rh3AG259700 Rh3AG259800 Rh3BG296300 Rh3DG289900 Rh5AG001600 Rh5AG288900 Rh5AG289000 Rh5AG289200 Rh5AG494800 Rh5AG495000 Rh5AG495200 Rh5AG495300 Rh5BG293000 Rh5BG293100 Rh5BG293300 Rh5BG516400 Rh5BG516500 Rh5BG516900 Rh5BG517000 Rh5CG001900 Rh5CG325700 Rh5CG325900 Rh5CG326000 Rh5CG540200 Rh5CG540300 Rh5CG540500 Rh5CG540600 Rh5DG001900 Rh5DG302900 Rh5DG303000 Rh5DG303200 Rh5DG529100 Rh5DG529300 Rh5DG529400 Rh5DG532500
rosa_wichuraiana Rw3G023420 Rw3G023430 Rw5G000210 Rw5G026800 Rw5G045910 Rw5G045920 Rw5G045930 Rw5G045940 Rw5G045950

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 47
AluBI AGCT 2 cut(s) 19, 111
AluI AGCT 2 cut(s) 19, 111
BccI CCATC 1 cut(s) 150
BclI TGATCA 1 cut(s) 157
BsaBI GATNNNNATC 1 cut(s) 162
Bse8I GATNNNNATC 1 cut(s) 162
BseGI GGATG 1 cut(s) 130
BseJI GATNNNNATC 1 cut(s) 162
Bsp143I GATC 1 cut(s) 157
BspHI TCATGA 1 cut(s) 154
BssMI GATC 1 cut(s) 157
BstDEI CTNAG 1 cut(s) 38
BstF5I GGATG 1 cut(s) 130
BstKTI GATC 1 cut(s) 160
BstMBI GATC 1 cut(s) 157
BstNSI RCATGY 1 cut(s) 29
BstXI CCANNNNNNTGG 1 cut(s) 99
BtsCI GGATG 1 cut(s) 130
CciI TCATGA 1 cut(s) 154
CviAII CATG 2 cut(s) 26, 155
CviJI RGCY 3 cut(s) 19, 79, 111
CviKI_1 RGCY 3 cut(s) 19, 79, 111
DdeI CTNAG 1 cut(s) 38
DpnI GATC 1 cut(s) 159
DpnII GATC 1 cut(s) 157
FaeI CATG 2 cut(s) 29, 158
FaiI YATR 6 cut(s) 27, 35, 114, 149, 156, 191
FatI CATG 2 cut(s) 25, 154
FbaI TGATCA 1 cut(s) 157
FokI GGATG 1 cut(s) 117
Hin1II CATG 2 cut(s) 29, 158
HindIII AAGCTT 1 cut(s) 17
Hpy188III TCNNGA 1 cut(s) 155
Hpy99I CGWCG 1 cut(s) 71
HpyF3I CTNAG 1 cut(s) 38
Hsp92II CATG 2 cut(s) 29, 158
Ksp22I TGATCA 1 cut(s) 157
Kzo9I GATC 1 cut(s) 157
MalI GATC 1 cut(s) 159
MboI GATC 1 cut(s) 157
MboII GAAGA 2 cut(s) 25, 59
MfeI CAATTG 1 cut(s) 178
MluCI AATT 1 cut(s) 178
MnlI CCTC 2 cut(s) 3, 144
MseI TTAA 1 cut(s) 54
MunI CAATTG 1 cut(s) 178
NdeII GATC 1 cut(s) 157
NlaIII CATG 2 cut(s) 29, 158
NspI RCATGY 1 cut(s) 29
PagI TCATGA 1 cut(s) 154
SaqAI TTAA 1 cut(s) 54
Sau3AI GATC 1 cut(s) 157
SetI ASST 2 cut(s) 21, 113
SgeI CNNG 7 cut(s) 32, 38, 82, 111, 120, 167, 182
Sse9I AATT 1 cut(s) 178
TasI AATT 1 cut(s) 178
Tru1I TTAA 1 cut(s) 54
Tru9I TTAA 1 cut(s) 54
TspDTI ATGAA 1 cut(s) 143
XceI RCATGY 1 cut(s) 29
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.