Rh5DG303200

transposition, RNA-mediated

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
OG0000276
Physical Location & Seq
Forward (+)
38115547 .. 38128913
13367 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG303200.1

Sequence Viewer

Length: 378 bp
ATGAAGCAAAAGATAACCATTGAGGCGAACATTTGGTGTGACAAATGTCGGTCCAAGGCCATGAAAATAGCTGCTGTAGAAGATGGTGTTAAATCAGTGGCTTTCAAGGGGGCAAGGAGAGACCAAATAGAGATAATCGGAGACGATGTTGATGCAACGGGATTGACCGGATTGCTGAGGAAGAAGCTCGGCTATGCAGACTTAGTGAGCCTGGAAGAAATAACCGAAAAGAAAGTTGATAAAGAGGAAAAGAAAACTAGCCAAGATGAGCAAAACACTAATAGTTATAGTCCAATTAGGGGAAGAAGATGTTGTCATCACCATGAGATGGAATTGCACATCTATGATCCACCATCAGGGAGATGCACCATTATGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
HMA

Protein Analysis

125

Amino Acids

14.17

Weight (kDa)

7.64

Isoelectric Point (pI)

58.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000276)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G05030 AT4G05030
fragaria_vesca FvH4_3g24080 FvH4_3g24080 FvH4_3g24100 FvH4_3g24100 FvH4_3g42050 FvH4_3g42060 FvH4_3g42070 FvH4_3g42071 FvH4_3g42080 FvH4_3g42090 FvH4_3g42100 FvH4_3g42110
malus_domestica MD03G1038100.v1.1 MD03G1038400.v1.1 MD03G1038600.v1.1 MD03G1038900.v1.1 MD03G1039000.v1.1 MD03G1039100.v1.1 MD03G1188500.v1.1 MD10G1233100.v1.1 MD10G1233300.v1.1 MD10G1341200.v1.1 MD11G1039200.v1.1 MD11G1039300.v1.1 MD11G1204400.v1.1 MD11G1204600.v1.1
prunus_persica Prupe.2G123900_v2.0.a1 Prupe.4G001900_v2.0.a1 Prupe.4G234700_v2.0.a1 Prupe.4G234800_v2.0.a1 Prupe.6G025900_v2.0.a1 Prupe.6G030200_v2.0.a1 Prupe.6G030300_v2.0.a1 Prupe.6G030400_v2.0.a1 Prupe.6G030600_v2.0.a1 Prupe.6G030900_v2.0.a1 Prupe.6G031000_v2.0.a1 Prupe.6G031100_v2.0.a1 Prupe.6G031100_v2.0.a1
pyrus_communis pycom03g02940 pycom03g02950 pycom03g02980 pycom03g02990 pycom03g03010 pycom11g03310 pycom11g03320
rosa_chinensis RchiOBHm_Chr3g0484311 RchiOBHm_Chr5g0000231 RchiOBHm_Chr5g0042661 RchiOBHm_Chr5g0042671 RchiOBHm_Chr5g0075281 RchiOBHm_Chr5g0075291 RchiOBHm_Chr5g0075321 RchiOBHm_Chr5g0075331
rosa_laevigata RLG00000034149 RLG00000036545 RLG00000036546 RLG00000036547 RLG00000036548 RLG00000036549 RLG00000036550
rosa_multiflora Rmu_sc0000295.1_g000011 Rmu_sc0000770.1_g000041 Rmu_sc0000770.1_g000049 Rmu_sc0002564.1_g000002 Rmu_sc0002564.1_g000003 Rmu_sc0002564.1_g000016
rosa_roxburghii Rroxscaffold_1G00006200 Rroxscaffold_1G00006210 Rroxscaffold_1G00006220 Rroxscaffold_1G00006250 Rroxscaffold_1G00006270 Rroxscaffold_1G00037900 Rroxscaffold_1G00037980 Rroxscaffold_6G00397790
rosa_rugosa Rorug03G0210600 Rorug05G0203800 Rorug05G0203900 Rorug05G0438100 Rorug05G0438200 Rorug05G0438700 Rorug05G0438900 Rorug05G0438900
rosa_samantha Rh3AG259700 Rh3AG259800 Rh3BG296300 Rh3DG289900 Rh5AG001600 Rh5AG288900 Rh5AG289000 Rh5AG289200 Rh5AG494800 Rh5AG495000 Rh5AG495200 Rh5AG495300 Rh5BG293000 Rh5BG293100 Rh5BG293300 Rh5BG516400 Rh5BG516500 Rh5BG516900 Rh5BG517000 Rh5CG001900 Rh5CG325700 Rh5CG325900 Rh5CG326000 Rh5CG540200 Rh5CG540300 Rh5CG540500 Rh5CG540600 Rh5DG001900 Rh5DG302900 Rh5DG303000 Rh5DG303200 Rh5DG529100 Rh5DG529300 Rh5DG529400 Rh5DG532500
rosa_wichuraiana Rw3G023420 Rw3G023430 Rw5G000210 Rw5G026800 Rw5G045910 Rw5G045920 Rw5G045930 Rw5G045940 Rw5G045950

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 328
AclWI GGATC 1 cut(s) 341
AfiI CCNNNNNNNGG 3 cut(s) 299, 328, 356
AgsI TTSAA 1 cut(s) 106
AjnI CCWGG 1 cut(s) 210
AluBI AGCT 2 cut(s) 71, 187
AluI AGCT 2 cut(s) 71, 187
Alw26I GTCTC 2 cut(s) 114, 135
AlwI GGATC 1 cut(s) 341
AoxI GGCC 1 cut(s) 57
ApeKI GCWGC 1 cut(s) 71
AspS9I GGNCC 1 cut(s) 51
AsuHPI GGTGA 1 cut(s) 311
AvaII GGWCC 1 cut(s) 51
BbvCI CCTCAGC 1 cut(s) 176
BbvI GCAGC 1 cut(s) 58
BccI CCATC 3 cut(s) 77, 322, 361
BcgI CGANNNNNNTGC 2 cut(s) 134, 168
BciT130I CCWGG 1 cut(s) 212
BcoDI GTCTC 2 cut(s) 114, 135
BfaI CTAG 1 cut(s) 258
BfmI CTRYAG 1 cut(s) 75
BisI GCNGC 1 cut(s) 72
BlsI GCNGC 1 cut(s) 73
Bme1390I CCNGG 1 cut(s) 212
Bme18I GGWCC 1 cut(s) 51
BmgT120I GGNCC 1 cut(s) 51
BmrFI CCNGG 1 cut(s) 212
BmsI GCATC 2 cut(s) 142, 353
BoxI GACNNNNGTC 1 cut(s) 45
Bpu10I CCTNAGC 1 cut(s) 176
BsaI GGTCTC 1 cut(s) 114
BsaJI CCNNGG 1 cut(s) 54
BsaWI WCCGGW 1 cut(s) 167
BsaXI ACNNNNNCTCC 2 cut(s) 132, 162
Bsc4I CCNNNNNNNGG 3 cut(s) 299, 328, 356
BseBI CCWGG 1 cut(s) 212
BseDI CCNNGG 1 cut(s) 54
BseLI CCNNNNNNNGG 3 cut(s) 299, 328, 356
BseMII CTCAG 1 cut(s) 167
BseXI GCAGC 1 cut(s) 58
BshFI GGCC 1 cut(s) 59
BsiSI CCGG 1 cut(s) 168
BslI CCNNNNNNNGG 3 cut(s) 299, 328, 356
BsmAI GTCTC 2 cut(s) 114, 135
BsmBI CGTCTC 1 cut(s) 135
BsnI GGCC 1 cut(s) 59
Bso31I GGTCTC 1 cut(s) 114
Bsp143I GATC 1 cut(s) 346
BspANI GGCC 1 cut(s) 59
BspCNI CTCAG 1 cut(s) 168
BspPI GGATC 1 cut(s) 341
BspTNI GGTCTC 1 cut(s) 114
BssECI CCNNGG 1 cut(s) 54
BssMI GATC 1 cut(s) 346
BssT1I CCWWGG 1 cut(s) 54
Bst2UI CCWGG 1 cut(s) 212
BstDEI CTNAG 2 cut(s) 176, 202
BstKTI GATC 1 cut(s) 349
BstMAI GTCTC 2 cut(s) 114, 135
BstMBI GATC 1 cut(s) 346
BstNI CCWGG 1 cut(s) 212
BstPAI GACNNNNGTC 1 cut(s) 45
BstSCI CCNGG 1 cut(s) 210
BstSFI CTRYAG 1 cut(s) 75
BstV1I GCAGC 1 cut(s) 58
BsuRI GGCC 1 cut(s) 59
BtsIMutI CAGTG 1 cut(s) 102
Cfr13I GGNCC 1 cut(s) 51
CviAII CATG 2 cut(s) 61, 323
CviJI RGCY 7 cut(s) 59, 71, 101, 187, 192, 210, 261
CviKI_1 RGCY 7 cut(s) 59, 71, 101, 187, 192, 210, 261
DdeI CTNAG 2 cut(s) 176, 202
DpnI GATC 1 cut(s) 348
DpnII GATC 1 cut(s) 346
Eco130I CCWWGG 1 cut(s) 54
Eco31I GGTCTC 1 cut(s) 114
Eco47I GGWCC 1 cut(s) 51
EcoRII CCWGG 1 cut(s) 210
EcoT14I CCWWGG 1 cut(s) 54
ErhI CCWWGG 1 cut(s) 54
Esp3I CGTCTC 1 cut(s) 135
FaeI CATG 2 cut(s) 64, 326
FaiI YATR 6 cut(s) 62, 195, 288, 324, 345, 374
FatI CATG 2 cut(s) 60, 322
Fnu4HI GCNGC 1 cut(s) 72
Fsp4HI GCNGC 1 cut(s) 72
FspBI CTAG 1 cut(s) 258
GluI GCNGC 1 cut(s) 72
HaeIII GGCC 1 cut(s) 59
HapII CCGG 1 cut(s) 168
Hin1II CATG 2 cut(s) 64, 326
HpaII CCGG 1 cut(s) 168
HphI GGTGA 1 cut(s) 311
Hpy188I TCNGA 1 cut(s) 140
HpyCH4V TGCA 4 cut(s) 155, 197, 337, 366
HpyF3I CTNAG 2 cut(s) 176, 202
Hsp92II CATG 2 cut(s) 64, 326
Kzo9I GATC 1 cut(s) 346
LpnPI CCDG 4 cut(s) 181, 197, 224, 342
Lsp1109I GCAGC 1 cut(s) 58
LweI GCATC 2 cut(s) 142, 353
MaeI CTAG 1 cut(s) 258
MaeIII GTNAC 1 cut(s) 38
MalI GATC 1 cut(s) 348
MboI GATC 1 cut(s) 346
MboII GAAGA 5 cut(s) 92, 193, 227, 315, 318
MluCI AATT 2 cut(s) 294, 332
MnlI CCTC 3 cut(s) 16, 171, 238
MseI TTAA 1 cut(s) 90
MslI CAYNNNNRTG 3 cut(s) 321, 342, 371
MspI CCGG 1 cut(s) 168
MspR9I CCNGG 1 cut(s) 212
MvaI CCWGG 1 cut(s) 212
NdeII GATC 1 cut(s) 346
NlaIII CATG 2 cut(s) 64, 326
NmeAIII GCCGAG 1 cut(s) 168
NmuCI GTSAC 1 cut(s) 38
PflMI CCANNNNNTGG 1 cut(s) 328
PkrI GCNGC 1 cut(s) 73
PshAI GACNNNNGTC 1 cut(s) 45
Psp6I CCWGG 1 cut(s) 210
PspGI CCWGG 1 cut(s) 210
PspPI GGNCC 1 cut(s) 51
RseI CAYNNNNRTG 3 cut(s) 321, 342, 371
SaqAI TTAA 1 cut(s) 90
SatI GCNGC 1 cut(s) 72
Sau3AI GATC 1 cut(s) 346
Sau96I GGNCC 1 cut(s) 51
ScrFI CCNGG 1 cut(s) 212
SetI ASST 2 cut(s) 73, 189
SfaNI GCATC 2 cut(s) 142, 353
SfcI CTRYAG 1 cut(s) 75
SinI GGWCC 1 cut(s) 51
SmiMI CAYNNNNRTG 3 cut(s) 321, 342, 371
Sse9I AATT 2 cut(s) 294, 332
SspMI CTAG 1 cut(s) 258
StyD4I CCNGG 1 cut(s) 210
StyI CCWWGG 1 cut(s) 54
TaqII GACCGA 1 cut(s) 39
TasI AATT 2 cut(s) 294, 332
Tru1I TTAA 1 cut(s) 90
Tru9I TTAA 1 cut(s) 90
TscAI CASTG 1 cut(s) 102
TseFI GTSAC 1 cut(s) 38
TseI GCWGC 1 cut(s) 71
Tsp45I GTSAC 1 cut(s) 38
TspDTI ATGAA 2 cut(s) 17, 77
TspRI CASTG 1 cut(s) 102
Van91I CCANNNNNTGG 1 cut(s) 328
VpaK11BI GGWCC 1 cut(s) 51
XspI CTAG 1 cut(s) 258
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.