Rh5CG325700

transposition, RNA-mediated

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
OG0000276
Physical Location & Seq
Forward (+)
36020115 .. 36020587
473 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG325700.1

Sequence Viewer

Length: 363 bp
ATGTTTCTGCAGCAAAAGATAACCATTGAGGCGAACATTTGGTGTGACAAATGTCGGTCCAAGGCCATGAAAATAGCTGCTGTAGAAGATGGTGTTAAATCAGTGGCTTTCAAGGGGGCAAGGAGAGACCAAATAGAGATAATCGGAGACGATGTTGATGCAACGGGATTGACCGGATTGCTGAGGAAGAAGCTCGGCTATGCAGACTTAGTGAGCTTGGAAGAAATAACCGAAACGAAAGTTGATAAAGAGGAAAAGAAACCTAGCCCTGATTGTCCAATTAGGGGAAGAAGAGGTTGTCACCACCATGAGATGGAATTGCACATCTATGATCCACCATCAGGGGGTTGCACCATTATGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
HMA

Protein Analysis

120

Amino Acids

13.4

Weight (kDa)

6.42

Isoelectric Point (pI)

62.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000276)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G05030 AT4G05030
fragaria_vesca FvH4_3g24080 FvH4_3g24080 FvH4_3g24100 FvH4_3g24100 FvH4_3g42050 FvH4_3g42060 FvH4_3g42070 FvH4_3g42071 FvH4_3g42080 FvH4_3g42090 FvH4_3g42100 FvH4_3g42110
malus_domestica MD03G1038100.v1.1 MD03G1038400.v1.1 MD03G1038600.v1.1 MD03G1038900.v1.1 MD03G1039000.v1.1 MD03G1039100.v1.1 MD03G1188500.v1.1 MD10G1233100.v1.1 MD10G1233300.v1.1 MD10G1341200.v1.1 MD11G1039200.v1.1 MD11G1039300.v1.1 MD11G1204400.v1.1 MD11G1204600.v1.1
prunus_persica Prupe.2G123900_v2.0.a1 Prupe.4G001900_v2.0.a1 Prupe.4G234700_v2.0.a1 Prupe.4G234800_v2.0.a1 Prupe.6G025900_v2.0.a1 Prupe.6G030200_v2.0.a1 Prupe.6G030300_v2.0.a1 Prupe.6G030400_v2.0.a1 Prupe.6G030600_v2.0.a1 Prupe.6G030900_v2.0.a1 Prupe.6G031000_v2.0.a1 Prupe.6G031100_v2.0.a1 Prupe.6G031100_v2.0.a1
pyrus_communis pycom03g02940 pycom03g02950 pycom03g02980 pycom03g02990 pycom03g03010 pycom11g03310 pycom11g03320
rosa_chinensis RchiOBHm_Chr3g0484311 RchiOBHm_Chr5g0000231 RchiOBHm_Chr5g0042661 RchiOBHm_Chr5g0042671 RchiOBHm_Chr5g0075281 RchiOBHm_Chr5g0075291 RchiOBHm_Chr5g0075321 RchiOBHm_Chr5g0075331
rosa_laevigata RLG00000034149 RLG00000036545 RLG00000036546 RLG00000036547 RLG00000036548 RLG00000036549 RLG00000036550
rosa_multiflora Rmu_sc0000295.1_g000011 Rmu_sc0000770.1_g000041 Rmu_sc0000770.1_g000049 Rmu_sc0002564.1_g000002 Rmu_sc0002564.1_g000003 Rmu_sc0002564.1_g000016
rosa_roxburghii Rroxscaffold_1G00006200 Rroxscaffold_1G00006210 Rroxscaffold_1G00006220 Rroxscaffold_1G00006250 Rroxscaffold_1G00006270 Rroxscaffold_1G00037900 Rroxscaffold_1G00037980 Rroxscaffold_6G00397790
rosa_rugosa Rorug03G0210600 Rorug05G0203800 Rorug05G0203900 Rorug05G0438100 Rorug05G0438200 Rorug05G0438700 Rorug05G0438900 Rorug05G0438900
rosa_samantha Rh3AG259700 Rh3AG259800 Rh3BG296300 Rh3DG289900 Rh5AG001600 Rh5AG288900 Rh5AG289000 Rh5AG289200 Rh5AG494800 Rh5AG495000 Rh5AG495200 Rh5AG495300 Rh5BG293000 Rh5BG293100 Rh5BG293300 Rh5BG516400 Rh5BG516500 Rh5BG516900 Rh5BG517000 Rh5CG001900 Rh5CG325700 Rh5CG325900 Rh5CG326000 Rh5CG540200 Rh5CG540300 Rh5CG540500 Rh5CG540600 Rh5DG001900 Rh5DG302900 Rh5DG303000 Rh5DG303200 Rh5DG529100 Rh5DG529300 Rh5DG529400 Rh5DG532500
rosa_wichuraiana Rw3G023420 Rw3G023430 Rw5G000210 Rw5G026800 Rw5G045910 Rw5G045920 Rw5G045930 Rw5G045940 Rw5G045950

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 313
AclWI GGATC 1 cut(s) 326
AfiI CCNNNNNNNGG 4 cut(s) 284, 313, 341, 344
AgsI TTSAA 1 cut(s) 112
AluBI AGCT 3 cut(s) 77, 193, 216
AluI AGCT 3 cut(s) 77, 193, 216
Alw26I GTCTC 2 cut(s) 120, 141
AlwI GGATC 1 cut(s) 326
AoxI GGCC 1 cut(s) 63
ApeKI GCWGC 2 cut(s) 10, 77
AspS9I GGNCC 1 cut(s) 57
AsuHPI GGTGA 1 cut(s) 293
AvaII GGWCC 1 cut(s) 57
BbvCI CCTCAGC 1 cut(s) 182
BbvI GCAGC 2 cut(s) 22, 64
BccI CCATC 3 cut(s) 83, 307, 346
BcgI CGANNNNNNTGC 2 cut(s) 140, 174
BcoDI GTCTC 2 cut(s) 120, 141
BfaI CTAG 1 cut(s) 264
BfmI CTRYAG 2 cut(s) 8, 81
BisI GCNGC 2 cut(s) 11, 78
BlsI GCNGC 2 cut(s) 12, 79
Bme18I GGWCC 1 cut(s) 57
BmgT120I GGNCC 1 cut(s) 57
BmsI GCATC 1 cut(s) 148
BoxI GACNNNNGTC 1 cut(s) 51
Bpu10I CCTNAGC 1 cut(s) 182
BsaI GGTCTC 1 cut(s) 120
BsaJI CCNNGG 1 cut(s) 60
BsaWI WCCGGW 1 cut(s) 173
BsaXI ACNNNNNCTCC 2 cut(s) 138, 168
Bsc4I CCNNNNNNNGG 4 cut(s) 284, 313, 341, 344
BseDI CCNNGG 1 cut(s) 60
BseLI CCNNNNNNNGG 4 cut(s) 284, 313, 341, 344
BseMII CTCAG 1 cut(s) 173
BseXI GCAGC 2 cut(s) 22, 64
BshFI GGCC 1 cut(s) 65
BsiSI CCGG 1 cut(s) 174
BslI CCNNNNNNNGG 4 cut(s) 284, 313, 341, 344
BsmAI GTCTC 2 cut(s) 120, 141
BsmBI CGTCTC 1 cut(s) 141
BsnI GGCC 1 cut(s) 65
Bso31I GGTCTC 1 cut(s) 120
Bsp143I GATC 1 cut(s) 331
BspANI GGCC 1 cut(s) 65
BspCNI CTCAG 1 cut(s) 174
BspMAI CTGCAG 1 cut(s) 12
BspPI GGATC 1 cut(s) 326
BspTNI GGTCTC 1 cut(s) 120
BssECI CCNNGG 1 cut(s) 60
BssMI GATC 1 cut(s) 331
BssT1I CCWWGG 1 cut(s) 60
Bst6I CTCTTC 1 cut(s) 286
BstDEI CTNAG 2 cut(s) 182, 208
BstKTI GATC 1 cut(s) 334
BstMAI GTCTC 2 cut(s) 120, 141
BstMBI GATC 1 cut(s) 331
BstPAI GACNNNNGTC 1 cut(s) 51
BstSFI CTRYAG 2 cut(s) 8, 81
BstV1I GCAGC 2 cut(s) 22, 64
BsuRI GGCC 1 cut(s) 65
BtsIMutI CAGTG 1 cut(s) 108
Cfr13I GGNCC 1 cut(s) 57
CviAII CATG 2 cut(s) 67, 308
CviJI RGCY 7 cut(s) 65, 77, 107, 193, 198, 216, 267
CviKI_1 RGCY 7 cut(s) 65, 77, 107, 193, 198, 216, 267
DdeI CTNAG 2 cut(s) 182, 208
DpnI GATC 1 cut(s) 333
DpnII GATC 1 cut(s) 331
Eam1104I CTCTTC 1 cut(s) 286
EarI CTCTTC 1 cut(s) 286
Eco130I CCWWGG 1 cut(s) 60
Eco31I GGTCTC 1 cut(s) 120
Eco47I GGWCC 1 cut(s) 57
EcoT14I CCWWGG 1 cut(s) 60
ErhI CCWWGG 1 cut(s) 60
Esp3I CGTCTC 1 cut(s) 141
FaeI CATG 2 cut(s) 70, 311
FaiI YATR 5 cut(s) 68, 201, 309, 330, 359
FatI CATG 2 cut(s) 66, 307
Fnu4HI GCNGC 2 cut(s) 11, 78
Fsp4HI GCNGC 2 cut(s) 11, 78
FspBI CTAG 1 cut(s) 264
GluI GCNGC 2 cut(s) 11, 78
HaeIII GGCC 1 cut(s) 65
HapII CCGG 1 cut(s) 174
Hin1II CATG 2 cut(s) 70, 311
HpaII CCGG 1 cut(s) 174
HphI GGTGA 1 cut(s) 293
Hpy188I TCNGA 1 cut(s) 146
HpyCH4V TGCA 5 cut(s) 10, 161, 203, 322, 351
HpyF3I CTNAG 2 cut(s) 182, 208
Hsp92II CATG 2 cut(s) 70, 311
Kzo9I GATC 1 cut(s) 331
LpnPI CCDG 3 cut(s) 187, 282, 327
Lsp1109I GCAGC 2 cut(s) 22, 64
LweI GCATC 1 cut(s) 148
MaeI CTAG 1 cut(s) 264
MaeIII GTNAC 2 cut(s) 44, 299
MalI GATC 1 cut(s) 333
MboI GATC 1 cut(s) 331
MboII GAAGA 5 cut(s) 98, 199, 233, 300, 303
MluCI AATT 2 cut(s) 279, 317
MnlI CCTC 4 cut(s) 22, 177, 244, 287
MseI TTAA 1 cut(s) 96
MslI CAYNNNNRTG 3 cut(s) 306, 327, 356
MspI CCGG 1 cut(s) 174
NdeII GATC 1 cut(s) 331
NlaIII CATG 2 cut(s) 70, 311
NmeAIII GCCGAG 1 cut(s) 174
NmuCI GTSAC 2 cut(s) 44, 299
PflMI CCANNNNNTGG 1 cut(s) 313
PkrI GCNGC 2 cut(s) 12, 79
PshAI GACNNNNGTC 1 cut(s) 51
PspPI GGNCC 1 cut(s) 57
PstI CTGCAG 1 cut(s) 12
RseI CAYNNNNRTG 3 cut(s) 306, 327, 356
SaqAI TTAA 1 cut(s) 96
SatI GCNGC 2 cut(s) 11, 78
Sau3AI GATC 1 cut(s) 331
Sau96I GGNCC 1 cut(s) 57
SetI ASST 5 cut(s) 79, 195, 218, 265, 298
SfaNI GCATC 1 cut(s) 148
SfcI CTRYAG 2 cut(s) 8, 81
SinI GGWCC 1 cut(s) 57
SmiMI CAYNNNNRTG 3 cut(s) 306, 327, 356
Sse9I AATT 2 cut(s) 279, 317
SspMI CTAG 1 cut(s) 264
StyI CCWWGG 1 cut(s) 60
TaqII GACCGA 1 cut(s) 45
TasI AATT 2 cut(s) 279, 317
Tru1I TTAA 1 cut(s) 96
Tru9I TTAA 1 cut(s) 96
TscAI CASTG 1 cut(s) 108
TseFI GTSAC 2 cut(s) 44, 299
TseI GCWGC 2 cut(s) 10, 77
Tsp45I GTSAC 2 cut(s) 44, 299
TspDTI ATGAA 1 cut(s) 83
TspRI CASTG 1 cut(s) 108
Van91I CCANNNNNTGG 1 cut(s) 313
VpaK11BI GGWCC 1 cut(s) 57
XspI CTAG 1 cut(s) 264
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.