Rh5DG303000

transposition, RNA-mediated

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
Physical Location & Seq
Forward (+)
38054706 .. 38055113
408 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG303000.1

Sequence Viewer

Length: 297 bp
ATGAAAATAGCTGCTGTAGAAGATGGTGTTAAATCAGTGGCTTTCAAGGGGGCAAGGAGAGACCAAATAGAGATAATCGGAGACGATGTTGATGCAACGGGATTGACCGGATTGCTGAGGAAGAAGCTCGGCTATGCAGACTTAGTGAGCTTGGAAGAAATAACCGAAACGAAAGTTGATAAAGAGGAAAAGAAACCTAGCCCTGATTGTCCAATTAGGGGAAGAAGAGGTTGTCACCACCATGAGATGGAATTGCACATCTATGATCCACCATCAGGGGGTTGCACCATTATGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

98

Amino Acids

10.79

Weight (kDa)

5.77

Isoelectric Point (pI)

55.29

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000276)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G05030 AT4G05030
fragaria_vesca FvH4_3g24080 FvH4_3g24080 FvH4_3g24100 FvH4_3g24100 FvH4_3g42050 FvH4_3g42060 FvH4_3g42070 FvH4_3g42071 FvH4_3g42080 FvH4_3g42090 FvH4_3g42100 FvH4_3g42110
malus_domestica MD03G1038100.v1.1 MD03G1038400.v1.1 MD03G1038600.v1.1 MD03G1038900.v1.1 MD03G1039000.v1.1 MD03G1039100.v1.1 MD03G1188500.v1.1 MD10G1233100.v1.1 MD10G1233300.v1.1 MD10G1341200.v1.1 MD11G1039200.v1.1 MD11G1039300.v1.1 MD11G1204400.v1.1 MD11G1204600.v1.1
prunus_persica Prupe.2G123900_v2.0.a1 Prupe.4G001900_v2.0.a1 Prupe.4G234700_v2.0.a1 Prupe.4G234800_v2.0.a1 Prupe.6G025900_v2.0.a1 Prupe.6G030200_v2.0.a1 Prupe.6G030300_v2.0.a1 Prupe.6G030400_v2.0.a1 Prupe.6G030600_v2.0.a1 Prupe.6G030900_v2.0.a1 Prupe.6G031000_v2.0.a1 Prupe.6G031100_v2.0.a1 Prupe.6G031100_v2.0.a1
pyrus_communis pycom03g02940 pycom03g02950 pycom03g02980 pycom03g02990 pycom03g03010 pycom11g03310 pycom11g03320
rosa_chinensis RchiOBHm_Chr3g0484311 RchiOBHm_Chr5g0000231 RchiOBHm_Chr5g0042661 RchiOBHm_Chr5g0042671 RchiOBHm_Chr5g0075281 RchiOBHm_Chr5g0075291 RchiOBHm_Chr5g0075321 RchiOBHm_Chr5g0075331
rosa_laevigata RLG00000034149 RLG00000036545 RLG00000036546 RLG00000036547 RLG00000036548 RLG00000036549 RLG00000036550
rosa_multiflora Rmu_sc0000295.1_g000011 Rmu_sc0000770.1_g000041 Rmu_sc0000770.1_g000049 Rmu_sc0002564.1_g000002 Rmu_sc0002564.1_g000003 Rmu_sc0002564.1_g000016
rosa_roxburghii Rroxscaffold_1G00006200 Rroxscaffold_1G00006210 Rroxscaffold_1G00006220 Rroxscaffold_1G00006250 Rroxscaffold_1G00006270 Rroxscaffold_1G00037900 Rroxscaffold_1G00037980 Rroxscaffold_6G00397790
rosa_rugosa Rorug03G0210600 Rorug05G0203800 Rorug05G0203900 Rorug05G0438100 Rorug05G0438200 Rorug05G0438700 Rorug05G0438900 Rorug05G0438900
rosa_samantha Rh3AG259700 Rh3AG259800 Rh3BG296300 Rh3DG289900 Rh5AG001600 Rh5AG288900 Rh5AG289000 Rh5AG289200 Rh5AG494800 Rh5AG495000 Rh5AG495200 Rh5AG495300 Rh5BG293000 Rh5BG293100 Rh5BG293300 Rh5BG516400 Rh5BG516500 Rh5BG516900 Rh5BG517000 Rh5CG001900 Rh5CG325700 Rh5CG325900 Rh5CG326000 Rh5CG540200 Rh5CG540300 Rh5CG540500 Rh5CG540600 Rh5DG001900 Rh5DG302900 Rh5DG303000 Rh5DG303200 Rh5DG529100 Rh5DG529300 Rh5DG529400 Rh5DG532500
rosa_wichuraiana Rw3G023420 Rw3G023430 Rw5G000210 Rw5G026800 Rw5G045910 Rw5G045920 Rw5G045930 Rw5G045940 Rw5G045950

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 247
AclWI GGATC 1 cut(s) 260
AfiI CCNNNNNNNGG 4 cut(s) 218, 247, 275, 278
AgsI TTSAA 1 cut(s) 46
AluBI AGCT 3 cut(s) 11, 127, 150
AluI AGCT 3 cut(s) 11, 127, 150
Alw26I GTCTC 2 cut(s) 54, 75
AlwI GGATC 1 cut(s) 260
ApeKI GCWGC 1 cut(s) 11
AsuHPI GGTGA 1 cut(s) 227
BbvCI CCTCAGC 1 cut(s) 116
BccI CCATC 3 cut(s) 17, 241, 280
BcgI CGANNNNNNTGC 2 cut(s) 74, 108
BcoDI GTCTC 2 cut(s) 54, 75
BfaI CTAG 1 cut(s) 198
BfmI CTRYAG 1 cut(s) 15
BisI GCNGC 1 cut(s) 12
BlsI GCNGC 1 cut(s) 13
BmsI GCATC 1 cut(s) 82
Bpu10I CCTNAGC 1 cut(s) 116
BsaI GGTCTC 1 cut(s) 54
BsaWI WCCGGW 1 cut(s) 107
BsaXI ACNNNNNCTCC 2 cut(s) 72, 102
Bsc4I CCNNNNNNNGG 4 cut(s) 218, 247, 275, 278
BseLI CCNNNNNNNGG 4 cut(s) 218, 247, 275, 278
BseMII CTCAG 1 cut(s) 107
BsiSI CCGG 1 cut(s) 108
BslI CCNNNNNNNGG 4 cut(s) 218, 247, 275, 278
BsmAI GTCTC 2 cut(s) 54, 75
BsmBI CGTCTC 1 cut(s) 75
Bso31I GGTCTC 1 cut(s) 54
Bsp143I GATC 1 cut(s) 265
BspCNI CTCAG 1 cut(s) 108
BspPI GGATC 1 cut(s) 260
BspTNI GGTCTC 1 cut(s) 54
BssMI GATC 1 cut(s) 265
Bst6I CTCTTC 1 cut(s) 220
BstDEI CTNAG 2 cut(s) 116, 142
BstKTI GATC 1 cut(s) 268
BstMAI GTCTC 2 cut(s) 54, 75
BstMBI GATC 1 cut(s) 265
BstSFI CTRYAG 1 cut(s) 15
BtsIMutI CAGTG 1 cut(s) 42
CviAII CATG 1 cut(s) 242
CviJI RGCY 6 cut(s) 11, 41, 127, 132, 150, 201
CviKI_1 RGCY 6 cut(s) 11, 41, 127, 132, 150, 201
DdeI CTNAG 2 cut(s) 116, 142
DpnI GATC 1 cut(s) 267
DpnII GATC 1 cut(s) 265
Eam1104I CTCTTC 1 cut(s) 220
EarI CTCTTC 1 cut(s) 220
Eco31I GGTCTC 1 cut(s) 54
Esp3I CGTCTC 1 cut(s) 75
FaeI CATG 1 cut(s) 245
FaiI YATR 4 cut(s) 135, 243, 264, 293
FatI CATG 1 cut(s) 241
Fnu4HI GCNGC 1 cut(s) 12
Fsp4HI GCNGC 1 cut(s) 12
FspBI CTAG 1 cut(s) 198
GluI GCNGC 1 cut(s) 12
HapII CCGG 1 cut(s) 108
Hin1II CATG 1 cut(s) 245
HpaII CCGG 1 cut(s) 108
HphI GGTGA 1 cut(s) 227
Hpy188I TCNGA 1 cut(s) 80
HpyCH4V TGCA 4 cut(s) 95, 137, 256, 285
HpyF3I CTNAG 2 cut(s) 116, 142
Hsp92II CATG 1 cut(s) 245
Kzo9I GATC 1 cut(s) 265
LpnPI CCDG 3 cut(s) 121, 216, 261
LweI GCATC 1 cut(s) 82
MaeI CTAG 1 cut(s) 198
MaeIII GTNAC 1 cut(s) 233
MalI GATC 1 cut(s) 267
MboI GATC 1 cut(s) 265
MboII GAAGA 5 cut(s) 32, 133, 167, 234, 237
MluCI AATT 2 cut(s) 213, 251
MnlI CCTC 3 cut(s) 111, 178, 221
MseI TTAA 1 cut(s) 30
MslI CAYNNNNRTG 3 cut(s) 240, 261, 290
MspI CCGG 1 cut(s) 108
NdeII GATC 1 cut(s) 265
NlaIII CATG 1 cut(s) 245
NmeAIII GCCGAG 1 cut(s) 108
NmuCI GTSAC 1 cut(s) 233
PflMI CCANNNNNTGG 1 cut(s) 247
PkrI GCNGC 1 cut(s) 13
RseI CAYNNNNRTG 3 cut(s) 240, 261, 290
SaqAI TTAA 1 cut(s) 30
SatI GCNGC 1 cut(s) 12
Sau3AI GATC 1 cut(s) 265
SetI ASST 5 cut(s) 13, 129, 152, 199, 232
SfaNI GCATC 1 cut(s) 82
SfcI CTRYAG 1 cut(s) 15
SmiMI CAYNNNNRTG 3 cut(s) 240, 261, 290
Sse9I AATT 2 cut(s) 213, 251
SspMI CTAG 1 cut(s) 198
TasI AATT 2 cut(s) 213, 251
Tru1I TTAA 1 cut(s) 30
Tru9I TTAA 1 cut(s) 30
TscAI CASTG 1 cut(s) 42
TseFI GTSAC 1 cut(s) 233
TseI GCWGC 1 cut(s) 11
Tsp45I GTSAC 1 cut(s) 233
TspDTI ATGAA 1 cut(s) 17
TspRI CASTG 1 cut(s) 42
Van91I CCANNNNNTGG 1 cut(s) 247
XspI CTAG 1 cut(s) 198
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.