pycom111g03680

nuclease HARBI1

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
SuperScaffold_111
OG0000697
Physical Location & Seq
Forward (+)
2274091 .. 2274390
300 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom111g03680.1

Sequence Viewer

Length: 300 bp
ATGATATTTGGTGTATTTAAATCTCGATTCACAATTTTTAAGTATGCACCTCCATTTCCAATTAAAACACAAGCAGAGTTAGTGTTAGCTTATGTAGGGTTGCACAACTTTCTTCGCAAGAAGTGTCGTTATGATGAATTTCCAATTGAACCAGAAGATGATGAATCTGAAGATGAAGAAAATGATGATGAACTAGGTAATCAAACTCAAGAGCAACAACGACAGATTGCTAATGCATGGAGAGCTGACATAGCTACAAATATGTGGACAGATGCTGTGAGTGATAGCATTCAAAGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DDE_Tnp_4

Protein Analysis

100

Amino Acids

11.62

Weight (kDa)

4.51

Isoelectric Point (pI)

45.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000697)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G35695
fragaria_vesca FvH4_4g17331 FvH4_6g20420 FvH4_6g24701 FvH4_6g52063
malus_domestica MD12G1024500.v1.1
prunus_persica Prupe.2G004900_v2.0.a1
pyrus_communis pycom10g09210 pycom111g03680 pycom12g13430 pycom16g19230
rosa_chinensis RchiOBHm_Chr5g0050651 RchiOBHm_Chr5g0054101 RchiOBHm_Chr6g0281391
rosa_multiflora Rmu_sc0000029.1_g000014 Rmu_sc0000147.1_g000039 Rmu_sc0000548.1_g000007 Rmu_sc0000913.1_g000001 Rmu_sc0000932.1_g000010 Rmu_sc0001304.1_g000041 Rmu_sc0001969.1_g000002 Rmu_sc0002357.1_g000042 Rmu_sc0002848.1_g000001 Rmu_sc0003113.1_g000003 Rmu_sc0003553.1_g000010 Rmu_sc0003642.1_g000003 Rmu_sc0004160.1_g000001 Rmu_sc0004511.1_g000001 Rmu_sc0004816.1_g000009 Rmu_sc0005500.1_g000008 Rmu_sc0005782.1_g000004 Rmu_sc0006833.1_g000005 Rmu_sc0007173.1_g000003 Rmu_sc0009973.1_g000001 Rmu_sc0016181.1_g000003 Rmu_sc0017974.1_g000001 Rmu_ssc0000255.1_g000020 Rmu_ssc0000263.1_g000011 Rmu_ssc0000366.1_g000012
rosa_roxburghii Rroxscaffold_1G00010110 Rroxscaffold_1G00023070 Rroxscaffold_1G00042980 Rroxscaffold_3G00273770 Rroxscaffold_4G00318480 Rroxscaffold_4G00323200 Rroxscaffold_5G00335150 Rroxscaffold_5G00340530 Rroxscaffold_5G00349500 Rroxscaffold_6G00401310 Rroxscaffold_6G00405610 Rroxscaffold_6G00409810 Rroxscaffold_7G00190250
rosa_rugosa Rorug04G0114300 Rorug05G0441600 Rorug07G0169600
rosa_wichuraiana Rw0G006340 Rw0G016280 Rw0G021420 Rw1G001890 Rw1G009310 Rw1G011130 Rw1G012600 Rw1G017460 Rw2G022560 Rw3G020960 Rw4G006850 Rw4G009950 Rw4G032810 Rw6G003640 Rw6G018030 Rw6G032240 Rw7G024530 Rw7G036060 Rw7G036830

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 137
AcuI CTGAAG 1 cut(s) 189
AgsI TTSAA 2 cut(s) 149, 293
AluBI AGCT 3 cut(s) 89, 245, 254
AluI AGCT 3 cut(s) 89, 245, 254
AlwNI CAGNNNCTG 1 cut(s) 275
ApoI RAATTY 1 cut(s) 137
BfaI CTAG 1 cut(s) 194
BmsI GCATC 1 cut(s) 262
BpuEI CTTGAG 1 cut(s) 192
BsmI GAATGC 1 cut(s) 288
BstMWI GCNNNNNNNGC 2 cut(s) 242, 251
CaiI CAGNNNCTG 1 cut(s) 275
CviAII CATG 1 cut(s) 237
CviJI RGCY 3 cut(s) 89, 245, 254
CviKI_1 RGCY 3 cut(s) 89, 245, 254
DraI TTTAAA 1 cut(s) 19
Eco57I CTGAAG 1 cut(s) 189
EcoT22I ATGCAT 1 cut(s) 238
FaeI CATG 1 cut(s) 240
FaiI YATR 6 cut(s) 45, 93, 132, 238, 251, 263
FatI CATG 1 cut(s) 236
FspBI CTAG 1 cut(s) 194
Hin1II CATG 1 cut(s) 240
HinfI GANTC 2 cut(s) 27, 164
Hpy166II GTNNAC 1 cut(s) 267
Hpy188I TCNGA 1 cut(s) 169
Hpy188III TCNNGA 2 cut(s) 24, 209
Hpy8I GTNNAC 1 cut(s) 267
HpyCH4V TGCA 3 cut(s) 47, 103, 236
HpyF10VI GCNNNNNNNGC 2 cut(s) 242, 251
Hsp92II CATG 1 cut(s) 240
LpnPI CCDG 1 cut(s) 165
LweI GCATC 1 cut(s) 262
MaeI CTAG 1 cut(s) 194
MboII GAAGA 4 cut(s) 104, 167, 182, 188
MfeI CAATTG 1 cut(s) 144
MluCI AATT 4 cut(s) 33, 60, 137, 144
MnlI CCTC 1 cut(s) 60
Mph1103I ATGCAT 1 cut(s) 238
MseI TTAA 3 cut(s) 18, 39, 63
MunI CAATTG 1 cut(s) 144
Mva1269I GAATGC 1 cut(s) 288
MwoI GCNNNNNNNGC 2 cut(s) 242, 251
NlaIII CATG 1 cut(s) 240
NsiI ATGCAT 1 cut(s) 238
PctI GAATGC 1 cut(s) 288
PfeI GAWTC 2 cut(s) 27, 164
PstNI CAGNNNCTG 1 cut(s) 275
SaqAI TTAA 3 cut(s) 18, 39, 63
SetI ASST 5 cut(s) 52, 91, 199, 247, 256
SfaNI GCATC 1 cut(s) 262
SgeI CNNG 7 cut(s) 36, 83, 130, 164, 206, 221, 249
SmiI ATTTAAAT 1 cut(s) 19
SmlI CTYRAG 1 cut(s) 207
SmoI CTYRAG 1 cut(s) 207
Sse9I AATT 4 cut(s) 33, 60, 137, 144
SspMI CTAG 1 cut(s) 194
SwaI ATTTAAAT 1 cut(s) 19
TaqI TCGA 1 cut(s) 25
TasI AATT 4 cut(s) 33, 60, 137, 144
TfiI GAWTC 2 cut(s) 27, 164
Tru1I TTAA 3 cut(s) 18, 39, 63
Tru9I TTAA 3 cut(s) 18, 39, 63
TspDTI ATGAA 4 cut(s) 150, 177, 189, 204
XapI RAATTY 1 cut(s) 137
XspI CTAG 1 cut(s) 194
Zsp2I ATGCAT 1 cut(s) 238
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.