Rmu_sc0004160.1_g000001

nuclease activity

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004160.1
OG0000697
Physical Location & Seq
Forward (+)
63 .. 1502
1440 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004160.1_g000001.1.cds

Sequence Viewer

Length: 768 bp
atgcttgcaacctttttaccagttgtcggccaaaataatcgatacagtgaagctcggctgatatttgagcgatctcattttgctgttagcagaagtttcaacaaagtcttgaaggccttgaatacaatagcaccacagtttatggctaaacctgagtccataccacctaacataagagaaagtacaaggttctatccttactttaaggattgtgtcggagctataaatggcacgcatattccagcaacagtagttggacgtgaggaatgtcgttcagatgaatttcctcctgaaccagaagaagattcgatagacaatcacgaagataattttgaatgggatgattttcaaacccaagatcagcaaagagagaatgctaatgaatggagaatgagtattgctactcatatgtggacagatgcccaaccaaatgccaacaatgaaaacaatgacaccacaatcttcaaatcagcaccaccatttttatataagacacaagtagaactagttttggcttgtgcaggactgcacaattttcttcgacaggaatgtcgttcagatgaatttcctcctgaaccagaagaagatccgatagacaatcacgaagataattttgaatgggatgattttcaaacccaagatcaacaaagagagaatgctaatgaatggagaatgagtattgctactcatatgtggacagatgcccagccaaatgctaacaatgaaaacaatgacaatcaagaaagtgaaaatgagagagaagaataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DDE_Tnp_4

Protein Analysis

255

Amino Acids

29.81

Weight (kDa)

4.43

Isoelectric Point (pI)

55.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000697)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G35695
fragaria_vesca FvH4_4g17331 FvH4_6g20420 FvH4_6g24701 FvH4_6g52063
malus_domestica MD12G1024500.v1.1
prunus_persica Prupe.2G004900_v2.0.a1
pyrus_communis pycom10g09210 pycom111g03680 pycom12g13430 pycom16g19230
rosa_chinensis RchiOBHm_Chr5g0050651 RchiOBHm_Chr5g0054101 RchiOBHm_Chr6g0281391
rosa_multiflora Rmu_sc0000029.1_g000014 Rmu_sc0000147.1_g000039 Rmu_sc0000548.1_g000007 Rmu_sc0000913.1_g000001 Rmu_sc0000932.1_g000010 Rmu_sc0001304.1_g000041 Rmu_sc0001969.1_g000002 Rmu_sc0002357.1_g000042 Rmu_sc0002848.1_g000001 Rmu_sc0003113.1_g000003 Rmu_sc0003553.1_g000010 Rmu_sc0003642.1_g000003 Rmu_sc0004160.1_g000001 Rmu_sc0004511.1_g000001 Rmu_sc0004816.1_g000009 Rmu_sc0005500.1_g000008 Rmu_sc0005782.1_g000004 Rmu_sc0006833.1_g000005 Rmu_sc0007173.1_g000003 Rmu_sc0009973.1_g000001 Rmu_sc0016181.1_g000003 Rmu_sc0017974.1_g000001 Rmu_ssc0000255.1_g000020 Rmu_ssc0000263.1_g000011 Rmu_ssc0000366.1_g000012
rosa_roxburghii Rroxscaffold_1G00010110 Rroxscaffold_1G00023070 Rroxscaffold_1G00042980 Rroxscaffold_3G00273770 Rroxscaffold_4G00318480 Rroxscaffold_4G00323200 Rroxscaffold_5G00335150 Rroxscaffold_5G00340530 Rroxscaffold_5G00349500 Rroxscaffold_6G00401310 Rroxscaffold_6G00405610 Rroxscaffold_6G00409810 Rroxscaffold_7G00190250
rosa_rugosa Rorug04G0114300 Rorug05G0441600 Rorug07G0169600
rosa_wichuraiana Rw0G006340 Rw0G016280 Rw0G021420 Rw1G001890 Rw1G009310 Rw1G011130 Rw1G012600 Rw1G017460 Rw2G022560 Rw3G020960 Rw4G006850 Rw4G009950 Rw4G032810 Rw6G003640 Rw6G018030 Rw6G032240 Rw7G024530 Rw7G036060 Rw7G036830

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 549
AclWI GGATC 1 cut(s) 581
AcoI YGGCCR 1 cut(s) 28
AcsI RAATTY 2 cut(s) 281, 563
AfaI GTAC 1 cut(s) 184
AfiI CCNNNNNNNGG 1 cut(s) 26
AgsI TTSAA 8 cut(s) 100, 112, 121, 335, 350, 466, 617, 632
AhlI ACTAGT 1 cut(s) 505
AjiI CACGTC 1 cut(s) 260
AluBI AGCT 2 cut(s) 53, 221
AluI AGCT 2 cut(s) 53, 221
AlwI GGATC 1 cut(s) 581
AoxI GGCC 2 cut(s) 28, 114
ApoI RAATTY 2 cut(s) 281, 563
BcuI ACTAGT 1 cut(s) 505
BfaI CTAG 1 cut(s) 506
BmgBI CACGTC 1 cut(s) 260
BmsI GCATC 2 cut(s) 409, 691
Bsa29I ATCGAT 1 cut(s) 40
BsaXI ACNNNNNCTCC 4 cut(s) 379, 409, 661, 691
Bsc4I CCNNNNNNNGG 1 cut(s) 26
Bse1I ACTGG 1 cut(s) 20
BseCI ATCGAT 1 cut(s) 40
BseGI GGATG 2 cut(s) 346, 628
BseLI CCNNNNNNNGG 1 cut(s) 26
BseMII CTCAG 1 cut(s) 144
BseNI ACTGG 1 cut(s) 20
BseYI CCCAGC 1 cut(s) 705
BsgI GTGCAG 2 cut(s) 512, 540
BshFI GGCC 2 cut(s) 30, 116
BshVI ATCGAT 1 cut(s) 40
BslI CCNNNNNNNGG 1 cut(s) 26
BsmI GAATGC 2 cut(s) 379, 661
BsnI GGCC 2 cut(s) 30, 116
Bsp143I GATC 4 cut(s) 71, 358, 586, 640
BspANI GGCC 2 cut(s) 30, 116
BspCNI CTCAG 1 cut(s) 145
BspDI ATCGAT 1 cut(s) 40
BspPI GGATC 1 cut(s) 581
BsrI ACTGG 1 cut(s) 20
BssMI GATC 4 cut(s) 71, 358, 586, 640
Bst4CI ACNGT 3 cut(s) 47, 138, 250
BstC8I GCNNGC 2 cut(s) 6, 233
BstDEI CTNAG 1 cut(s) 153
BstF5I GGATG 2 cut(s) 346, 628
BstKTI GATC 4 cut(s) 74, 361, 589, 643
BstMBI GATC 4 cut(s) 71, 358, 586, 640
BstX2I RGATCY 1 cut(s) 586
BstYI RGATCY 1 cut(s) 586
Bsu15I ATCGAT 1 cut(s) 40
BsuRI GGCC 2 cut(s) 30, 116
BsuTUI ATCGAT 1 cut(s) 40
BtrI CACGTC 1 cut(s) 260
BtsCI GGATG 2 cut(s) 346, 628
BtsIMutI CAGTG 1 cut(s) 52
Cac8I GCNNGC 2 cut(s) 6, 233
ClaI ATCGAT 1 cut(s) 40
Csp6I GTAC 1 cut(s) 183
CviJI RGCY 8 cut(s) 30, 53, 58, 116, 146, 221, 515, 709
CviKI_1 RGCY 8 cut(s) 30, 53, 58, 116, 146, 221, 515, 709
CviQI GTAC 1 cut(s) 183
DdeI CTNAG 1 cut(s) 153
DpnI GATC 4 cut(s) 73, 360, 588, 642
DpnII GATC 4 cut(s) 71, 358, 586, 640
DrdI GACNNNNNNGTC 1 cut(s) 549
DseDI GACNNNNNNGTC 1 cut(s) 549
EaeI YGGCCR 1 cut(s) 28
Eco147I AGGCCT 1 cut(s) 116
FauNDI CATATG 2 cut(s) 408, 690
FokI GGATG 2 cut(s) 353, 635
FspBI CTAG 1 cut(s) 506
GsaI CCCAGC 1 cut(s) 709
HaeIII GGCC 2 cut(s) 30, 116
HinfI GANTC 2 cut(s) 155, 305
Hpy166II GTNNAC 2 cut(s) 414, 696
Hpy188I TCNGA 4 cut(s) 218, 277, 559, 591
Hpy188III TCNNGA 6 cut(s) 109, 290, 320, 572, 602, 740
Hpy8I GTNNAC 2 cut(s) 414, 696
HpyAV CCTTC 1 cut(s) 106
HpyCH4III ACNGT 3 cut(s) 47, 138, 250
HpyCH4IV ACGT 1 cut(s) 259
HpyCH4V TGCA 3 cut(s) 8, 521, 529
HpyF3I CTNAG 1 cut(s) 153
HpySE526I ACGT 1 cut(s) 259
Kzo9I GATC 4 cut(s) 71, 358, 586, 640
LmnI GCTCC 1 cut(s) 218
LweI GCATC 2 cut(s) 409, 691
MaeI CTAG 1 cut(s) 506
MaeII ACGT 1 cut(s) 259
MalI GATC 4 cut(s) 73, 360, 588, 642
MboI GATC 4 cut(s) 71, 358, 586, 640
MboII GAAGA 8 cut(s) 311, 314, 335, 454, 530, 593, 596, 617
MflI RGATCY 1 cut(s) 586
MluCI AATT 5 cut(s) 281, 328, 532, 563, 610
MlyI GAGTC 1 cut(s) 164
MmeI TCCRAC 2 cut(s) 196, 235
MnlI CCTC 3 cut(s) 256, 297, 579
MseI TTAA 1 cut(s) 204
Mva1269I GAATGC 2 cut(s) 379, 661
NdeI CATATG 2 cut(s) 408, 690
NdeII GATC 4 cut(s) 71, 358, 586, 640
NmeAIII GCCGAG 1 cut(s) 34
PceI AGGCCT 1 cut(s) 116
PctI GAATGC 2 cut(s) 379, 661
PfeI GAWTC 1 cut(s) 305
PleI GAGTC 1 cut(s) 163
PpsI GAGTC 1 cut(s) 163
PspFI CCCAGC 1 cut(s) 705
PsuI RGATCY 1 cut(s) 586
RsaI GTAC 1 cut(s) 184
RsaNI GTAC 1 cut(s) 183
SaqAI TTAA 1 cut(s) 204
Sau3AI GATC 4 cut(s) 71, 358, 586, 640
SchI GAGTC 1 cut(s) 164
SetI ASST 7 cut(s) 14, 55, 154, 169, 191, 223, 262
SfaNI GCATC 2 cut(s) 409, 691
SpeI ACTAGT 1 cut(s) 505
Sse9I AATT 5 cut(s) 281, 328, 532, 563, 610
SseBI AGGCCT 1 cut(s) 116
SspMI CTAG 1 cut(s) 506
StuI AGGCCT 1 cut(s) 116
TaaI ACNGT 3 cut(s) 47, 138, 250
TaiI ACGT 1 cut(s) 262
TaqI TCGA 3 cut(s) 40, 308, 541
TasI AATT 5 cut(s) 281, 328, 532, 563, 610
TatI WGTACW 1 cut(s) 182
TfiI GAWTC 1 cut(s) 305
Tru1I TTAA 1 cut(s) 204
Tru9I TTAA 1 cut(s) 204
TscAI CASTG 1 cut(s) 52
TspDTI ATGAA 6 cut(s) 294, 396, 456, 576, 678, 738
TspRI CASTG 1 cut(s) 52
XapI RAATTY 2 cut(s) 281, 563
XspI CTAG 1 cut(s) 506
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.