Rroxscaffold_6G00409810
MYB Family

Myb/SANT-like DNA-binding domain

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000006
Physical Location & Seq
Forward (+)
32309220 .. 32312285
3066 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_6G00409810.1

Sequence Viewer

Length: 333 bp
ATGACTTCGTACATAGAATGTCGTGAGGATGAATTTCCTGTTGAACCAGAAAATGATTCATCATCTTCATCCTATCTAGATATGGAAGATGAGAATCTTGAACTACTTTCTCAAAGTCAACAACGACAAAGAGCGGAGGCTAATGCTTGGAGGCTTACTATTGTTGAAGCTATGTGGGAAGATAGACTGCGAAATGATGATAATGAAAGTCAAGAGAATAACAATAATACTCAAGACAATGAGAATGAGAATAATGAGGAACATATGGATGACGGGGAACAAGAAGGTTATGATGATAATGAGGTTGGAATGGATAAGTATGCAGCTTTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

110

Amino Acids

12.95

Weight (kDa)

4.05

Isoelectric Point (pI)

63.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000697)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G35695
fragaria_vesca FvH4_4g17331 FvH4_6g20420 FvH4_6g24701 FvH4_6g52063
malus_domestica MD12G1024500.v1.1
prunus_persica Prupe.2G004900_v2.0.a1
pyrus_communis pycom10g09210 pycom111g03680 pycom12g13430 pycom16g19230
rosa_chinensis RchiOBHm_Chr5g0050651 RchiOBHm_Chr5g0054101 RchiOBHm_Chr6g0281391
rosa_multiflora Rmu_sc0000029.1_g000014 Rmu_sc0000147.1_g000039 Rmu_sc0000548.1_g000007 Rmu_sc0000913.1_g000001 Rmu_sc0000932.1_g000010 Rmu_sc0001304.1_g000041 Rmu_sc0001969.1_g000002 Rmu_sc0002357.1_g000042 Rmu_sc0002848.1_g000001 Rmu_sc0003113.1_g000003 Rmu_sc0003553.1_g000010 Rmu_sc0003642.1_g000003 Rmu_sc0004160.1_g000001 Rmu_sc0004511.1_g000001 Rmu_sc0004816.1_g000009 Rmu_sc0005500.1_g000008 Rmu_sc0005782.1_g000004 Rmu_sc0006833.1_g000005 Rmu_sc0007173.1_g000003 Rmu_sc0009973.1_g000001 Rmu_sc0016181.1_g000003 Rmu_sc0017974.1_g000001 Rmu_ssc0000255.1_g000020 Rmu_ssc0000263.1_g000011 Rmu_ssc0000366.1_g000012
rosa_roxburghii Rroxscaffold_1G00010110 Rroxscaffold_1G00023070 Rroxscaffold_1G00042980 Rroxscaffold_3G00273770 Rroxscaffold_4G00318480 Rroxscaffold_4G00323200 Rroxscaffold_5G00335150 Rroxscaffold_5G00340530 Rroxscaffold_5G00349500 Rroxscaffold_6G00401310 Rroxscaffold_6G00405610 Rroxscaffold_6G00409810 Rroxscaffold_7G00190250
rosa_rugosa Rorug04G0114300 Rorug05G0441600 Rorug07G0169600
rosa_wichuraiana Rw0G006340 Rw0G016280 Rw0G021420 Rw1G001890 Rw1G009310 Rw1G011130 Rw1G012600 Rw1G017460 Rw2G022560 Rw3G020960 Rw4G006850 Rw4G009950 Rw4G032810 Rw6G003640 Rw6G018030 Rw6G032240 Rw7G024530 Rw7G036060 Rw7G036830

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 134
AciI CCGC 1 cut(s) 134
AcsI RAATTY 1 cut(s) 32
AfaI GTAC 1 cut(s) 11
AgsI TTSAA 3 cut(s) 44, 101, 167
AluBI AGCT 2 cut(s) 170, 326
AluI AGCT 2 cut(s) 170, 326
ApeKI GCWGC 1 cut(s) 323
ApoI RAATTY 1 cut(s) 32
BfaI CTAG 1 cut(s) 77
BisI GCNGC 1 cut(s) 324
BlsI GCNGC 1 cut(s) 325
BpuEI CTTGAG 1 cut(s) 216
BsaBI GATNNNNATC 1 cut(s) 93
Bse8I GATNNNNATC 1 cut(s) 93
BseGI GGATG 3 cut(s) 34, 68, 274
BseJI GATNNNNATC 1 cut(s) 93
BspACI CCGC 1 cut(s) 134
BsrBI CCGCTC 1 cut(s) 134
BstF5I GGATG 3 cut(s) 34, 68, 274
BtsCI GGATG 3 cut(s) 34, 68, 274
Csp6I GTAC 1 cut(s) 10
CviJI RGCY 4 cut(s) 140, 154, 170, 326
CviKI_1 RGCY 4 cut(s) 140, 154, 170, 326
CviQI GTAC 1 cut(s) 10
FaiI YATR 7 cut(s) 14, 83, 173, 264, 266, 291, 321
FauNDI CATATG 1 cut(s) 264
Fnu4HI GCNGC 1 cut(s) 324
FokI GGATG 3 cut(s) 41, 55, 281
Fsp4HI GCNGC 1 cut(s) 324
FspBI CTAG 1 cut(s) 77
GluI GCNGC 1 cut(s) 324
HincII GTYRAC 1 cut(s) 119
HindII GTYRAC 1 cut(s) 119
HinfI GANTC 2 cut(s) 56, 94
Hpy166II GTNNAC 1 cut(s) 119
Hpy188III TCNNGA 5 cut(s) 23, 77, 98, 212, 233
Hpy8I GTNNAC 1 cut(s) 119
HpyAV CCTTC 1 cut(s) 278
HpyCH4V TGCA 1 cut(s) 323
LpnPI CCDG 2 cut(s) 51, 60
MaeI CTAG 1 cut(s) 77
MbiI CCGCTC 1 cut(s) 134
MboII GAAGA 3 cut(s) 57, 98, 191
MluCI AATT 1 cut(s) 32
MmeI TCCRAC 1 cut(s) 286
MnlI CCTC 5 cut(s) 19, 130, 144, 250, 295
MslI CAYNNNNRTG 1 cut(s) 267
NdeI CATATG 1 cut(s) 264
PfeI GAWTC 2 cut(s) 56, 94
PkrI GCNGC 1 cut(s) 325
RsaI GTAC 1 cut(s) 11
RsaNI GTAC 1 cut(s) 10
RseI CAYNNNNRTG 1 cut(s) 267
SatI GCNGC 1 cut(s) 324
SetI ASST 4 cut(s) 172, 289, 306, 328
SmiMI CAYNNNNRTG 1 cut(s) 267
SmlI CTYRAG 1 cut(s) 231
SmoI CTYRAG 1 cut(s) 231
Sse9I AATT 1 cut(s) 32
SsiI CCGC 1 cut(s) 134
SspMI CTAG 1 cut(s) 77
TasI AATT 1 cut(s) 32
TfiI GAWTC 2 cut(s) 56, 94
TseI GCWGC 1 cut(s) 323
TspDTI ATGAA 4 cut(s) 45, 48, 57, 219
XapI RAATTY 1 cut(s) 32
XbaI TCTAGA 1 cut(s) 76
XspI CTAG 1 cut(s) 77
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.