Rmu_sc0000147.1_g000039
MYB Family

Myb/SANT-like DNA-binding domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000147.1
OG0000697
Physical Location & Seq
Reverse (-)
172986 .. 173923
938 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000147.1_g000039.1.cds

Sequence Viewer

Length: 690 bp
atggtaaaaggtcgagaagtaagcagctatcgtaaccgacatggtattcaatctcaaaatgttttggctgcttgcaatttcgatttggaattcaaatacatgcttagtgggtgggaaggttcgacacatgattcaaagttgctaaatgatgccttatcaagaagaaatggaattgaagtgcctcaaggtcgccaccccaaaaatgcaagtgagttgtttaatctttgccatgcatcattgaggagtgtgattgaaatgatatttggtatctttaaatcacggttcacaattttcaaaatcgcacttcccttcccatttgagacacaagcggagttagtgttagcttgtgctggactacataactttcttcgcaaagaatgtcgctccgatgaatttcctgttgaaccagaagatgatcagtcttcatcatatctaggcatggaagatgaaaatcttgaactactttctcaaagccaacaacaacaaagggcggaagctaatgcttggagaattagcattgctgatgctatgtggaatgataggccgcggaatgatgataatggaaatcaagaggataacaatgaggatcaaaacaatgacaatgagaataatgaggaacacataaatgatgagaatcaggaggtttacgatgataatgaggttggaatggaggagtatgcatcattctaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DDE_Tnp_4

Protein Analysis

229

Amino Acids

26.37

Weight (kDa)

4.53

Isoelectric Point (pI)

62.92

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000697)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G35695
fragaria_vesca FvH4_4g17331 FvH4_6g20420 FvH4_6g24701 FvH4_6g52063
malus_domestica MD12G1024500.v1.1
prunus_persica Prupe.2G004900_v2.0.a1
pyrus_communis pycom10g09210 pycom111g03680 pycom12g13430 pycom16g19230
rosa_chinensis RchiOBHm_Chr5g0050651 RchiOBHm_Chr5g0054101 RchiOBHm_Chr6g0281391
rosa_multiflora Rmu_sc0000029.1_g000014 Rmu_sc0000147.1_g000039 Rmu_sc0000548.1_g000007 Rmu_sc0000913.1_g000001 Rmu_sc0000932.1_g000010 Rmu_sc0001304.1_g000041 Rmu_sc0001969.1_g000002 Rmu_sc0002357.1_g000042 Rmu_sc0002848.1_g000001 Rmu_sc0003113.1_g000003 Rmu_sc0003553.1_g000010 Rmu_sc0003642.1_g000003 Rmu_sc0004160.1_g000001 Rmu_sc0004511.1_g000001 Rmu_sc0004816.1_g000009 Rmu_sc0005500.1_g000008 Rmu_sc0005782.1_g000004 Rmu_sc0006833.1_g000005 Rmu_sc0007173.1_g000003 Rmu_sc0009973.1_g000001 Rmu_sc0016181.1_g000003 Rmu_sc0017974.1_g000001 Rmu_ssc0000255.1_g000020 Rmu_ssc0000263.1_g000011 Rmu_ssc0000366.1_g000012
rosa_roxburghii Rroxscaffold_1G00010110 Rroxscaffold_1G00023070 Rroxscaffold_1G00042980 Rroxscaffold_3G00273770 Rroxscaffold_4G00318480 Rroxscaffold_4G00323200 Rroxscaffold_5G00335150 Rroxscaffold_5G00340530 Rroxscaffold_5G00349500 Rroxscaffold_6G00401310 Rroxscaffold_6G00405610 Rroxscaffold_6G00409810 Rroxscaffold_7G00190250
rosa_rugosa Rorug04G0114300 Rorug05G0441600 Rorug07G0169600
rosa_wichuraiana Rw0G006340 Rw0G016280 Rw0G021420 Rw1G001890 Rw1G009310 Rw1G011130 Rw1G012600 Rw1G017460 Rw2G022560 Rw3G020960 Rw4G006850 Rw4G009950 Rw4G032810 Rw6G003640 Rw6G018030 Rw6G032240 Rw7G024530 Rw7G036060 Rw7G036830

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 547
AciI CCGC 4 cut(s) 329, 491, 545, 547
AclWI GGATC 1 cut(s) 594
AcsI RAATTY 2 cut(s) 89, 392
AgsI TTSAA 8 cut(s) 50, 94, 135, 176, 254, 295, 404, 458
AjuI GAANNNNNNNTTGG 2 cut(s) 246, 278
AluBI AGCT 3 cut(s) 27, 344, 497
AluI AGCT 3 cut(s) 27, 344, 497
Alw26I GTCTC 1 cut(s) 314
AlwI GGATC 1 cut(s) 594
AoxI GGCC 1 cut(s) 542
ApeKI GCWGC 2 cut(s) 24, 68
ApoI RAATTY 2 cut(s) 89, 392
BbsI GAAGAC 1 cut(s) 414
BbvI GCAGC 2 cut(s) 36, 55
BclI TGATCA 1 cut(s) 415
BcoDI GTCTC 1 cut(s) 314
BfaI CTAG 1 cut(s) 434
BisI GCNGC 3 cut(s) 25, 69, 545
BlsI GCNGC 3 cut(s) 26, 70, 546
BmsI GCATC 3 cut(s) 139, 242, 514
BpiI GAAGAC 1 cut(s) 414
BpuEI CTTGAG 1 cut(s) 168
BsaBI GATNNNNATC 2 cut(s) 450, 633
BsaJI CCNNGG 1 cut(s) 545
BsaXI ACNNNNNCTCC 2 cut(s) 323, 353
Bse3DI GCAATG 1 cut(s) 516
Bse8I GATNNNNATC 2 cut(s) 450, 633
BseDI CCNNGG 1 cut(s) 545
BseJI GATNNNNATC 2 cut(s) 450, 633
BseMI GCAATG 1 cut(s) 516
BseRI GAGGAG 2 cut(s) 256, 686
BseXI GCAGC 2 cut(s) 36, 55
Bsh1236I CGCG 1 cut(s) 547
BshFI GGCC 1 cut(s) 544
BsmAI GTCTC 1 cut(s) 314
BsnI GGCC 1 cut(s) 544
Bsp143I GATC 2 cut(s) 415, 586
BspACI CCGC 4 cut(s) 329, 491, 545, 547
BspANI GGCC 1 cut(s) 544
BspFNI CGCG 1 cut(s) 547
BspPI GGATC 1 cut(s) 594
BsrDI GCAATG 1 cut(s) 516
BssECI CCNNGG 1 cut(s) 545
BssMI GATC 2 cut(s) 415, 586
Bst4CI ACNGT 1 cut(s) 282
BstC8I GCNNGC 1 cut(s) 73
BstDEI CTNAG 1 cut(s) 104
BstDSI CCRYGG 1 cut(s) 545
BstFNI CGCG 1 cut(s) 547
BstKTI GATC 2 cut(s) 418, 589
BstMAI GTCTC 1 cut(s) 314
BstMBI GATC 2 cut(s) 415, 586
BstNSI RCATGY 1 cut(s) 103
BstUI CGCG 1 cut(s) 547
BstV1I GCAGC 2 cut(s) 36, 55
BstV2I GAAGAC 1 cut(s) 414
BsuRI GGCC 1 cut(s) 544
BtgI CCRYGG 1 cut(s) 545
Cac8I GCNNGC 1 cut(s) 73
Cfr42I CCGCGG 1 cut(s) 548
CviAII CATG 5 cut(s) 41, 100, 128, 230, 439
CviJI RGCY 6 cut(s) 27, 68, 344, 474, 497, 544
CviKI_1 RGCY 6 cut(s) 27, 68, 344, 474, 497, 544
DdeI CTNAG 1 cut(s) 104
DpnI GATC 2 cut(s) 417, 588
DpnII GATC 2 cut(s) 415, 586
DraI TTTAAA 1 cut(s) 274
EciI GGCGGA 1 cut(s) 506
EcoRI GAATTC 1 cut(s) 89
EcoT22I ATGCAT 2 cut(s) 235, 682
FaeI CATG 5 cut(s) 44, 103, 131, 233, 442
FatI CATG 5 cut(s) 40, 99, 127, 229, 438
FbaI TGATCA 1 cut(s) 415
Fnu4HI GCNGC 3 cut(s) 25, 69, 545
Fsp4HI GCNGC 3 cut(s) 25, 69, 545
FspBI CTAG 1 cut(s) 434
GluI GCNGC 3 cut(s) 25, 69, 545
HaeIII GGCC 1 cut(s) 544
Hin1II CATG 5 cut(s) 44, 103, 131, 233, 442
HinfI GANTC 2 cut(s) 131, 634
Hpy166II GTNNAC 2 cut(s) 285, 646
Hpy188I TCNGA 1 cut(s) 388
Hpy188III TCNNGA 5 cut(s) 14, 159, 455, 569, 638
Hpy8I GTNNAC 2 cut(s) 285, 646
HpyAV CCTTC 2 cut(s) 110, 319
HpyCH4III ACNGT 1 cut(s) 282
HpyCH4V TGCA 4 cut(s) 75, 206, 233, 680
HpyF3I CTNAG 1 cut(s) 104
Hsp92II CATG 5 cut(s) 44, 103, 131, 233, 442
Ksp22I TGATCA 1 cut(s) 415
KspI CCGCGG 1 cut(s) 548
Kzo9I GATC 2 cut(s) 415, 586
LmnI GCTCC 1 cut(s) 389
LpnPI CCDG 4 cut(s) 336, 411, 420, 623
Lsp1109I GCAGC 2 cut(s) 36, 55
LweI GCATC 3 cut(s) 139, 242, 514
MaeI CTAG 1 cut(s) 434
MaeIII GTNAC 1 cut(s) 32
MalI GATC 2 cut(s) 417, 588
MboI GATC 2 cut(s) 415, 586
MboII GAAGA 5 cut(s) 174, 359, 414, 422, 455
MluCI AATT 6 cut(s) 76, 89, 171, 288, 392, 510
MmeI TCCRAC 1 cut(s) 643
MnlI CCTC 8 cut(s) 192, 234, 565, 577, 607, 634, 652, 664
Mph1103I ATGCAT 2 cut(s) 235, 682
MseI TTAA 2 cut(s) 219, 273
MslI CAYNNNNRTG 1 cut(s) 624
MspA1I CMGCKG 1 cut(s) 547
MvnI CGCG 1 cut(s) 547
NdeII GATC 2 cut(s) 415, 586
NlaIII CATG 5 cut(s) 44, 103, 131, 233, 442
NsiI ATGCAT 2 cut(s) 235, 682
NspI RCATGY 1 cut(s) 103
PfeI GAWTC 2 cut(s) 131, 634
PkrI GCNGC 3 cut(s) 26, 70, 546
RseI CAYNNNNRTG 1 cut(s) 624
SacII CCGCGG 1 cut(s) 548
SaqAI TTAA 2 cut(s) 219, 273
SatI GCNGC 3 cut(s) 25, 69, 545
Sau3AI GATC 2 cut(s) 415, 586
SetI ASST 8 cut(s) 13, 29, 121, 190, 346, 499, 645, 663
SfaNI GCATC 3 cut(s) 139, 242, 514
Sfr303I CCGCGG 1 cut(s) 548
SgrBI CCGCGG 1 cut(s) 548
SmiMI CAYNNNNRTG 1 cut(s) 624
SmlI CTYRAG 1 cut(s) 183
SmoI CTYRAG 1 cut(s) 183
Sse9I AATT 6 cut(s) 76, 89, 171, 288, 392, 510
SsiI CCGC 4 cut(s) 329, 491, 545, 547
SspMI CTAG 1 cut(s) 434
TaaI ACNGT 1 cut(s) 282
TaqI TCGA 3 cut(s) 13, 81, 122
TasI AATT 6 cut(s) 76, 89, 171, 288, 392, 510
TauI GCSGC 1 cut(s) 547
TfiI GAWTC 2 cut(s) 131, 634
Tru1I TTAA 2 cut(s) 219, 273
Tru9I TTAA 2 cut(s) 219, 273
TseI GCWGC 2 cut(s) 24, 68
TspDTI ATGAA 3 cut(s) 405, 414, 462
XapI RAATTY 2 cut(s) 89, 392
XceI RCATGY 1 cut(s) 103
XspI CTAG 1 cut(s) 434
Zsp2I ATGCAT 2 cut(s) 235, 682
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.