Rmu_sc0001304.1_g000041
MYB Family

Myb/SANT-like DNA-binding domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001304.1
OG0000697
Physical Location & Seq
Forward (+)
160765 .. 163834
3070 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001304.1_g000041.1.cds

Sequence Viewer

Length: 1842 bp
atggttgatccacaacaagatggaaaaaaaaatgggaattatgagcagtggaccaaggaagagagtgataccttattagaactaatggttgatgccgccgttaggggatggcgtgacaatagtggcatcttaagtaagcaaacagtggaagaaagaatacttcctgttcttaatgcaaaacttgggtgtcacaagacatacaaaaactaccaaagcagggttagatggtttaaaggtcgatggaactcttactctacccttatgtgttttagctctagttttggatttgattcaactacaaagaggtttactgcttctaatgaagtatgggaggaataccttaaggacaccgacttgcgctatgggacatttgatgattatgaggacttggaaattgctattgggaatggtgtagcggttgggaaaaactcggtcgggttgggtagtgttactgatgcaagaacattaggtgttggtgaaggtagagaggcatgcatagaagactttgattatgatatagattgtgaagcatttgttgaaccaaatcaaaataatccatcaactcatccaatatcacccctccaatcccctaaaattttagaggttccgaaaaaaatggaaggggaagaaatagatggggaagagatagggggagaagaaatagatgaagaagaatttgaagaggaattttatgaaacaatcaagtatttattgattgcatttcaggcaataaccattgtgttaagagacactatgaacactatgaatatgatgcatcaacgtattcatcgtcctcgcaaacgacgacctattactaagaaaggatatcattacatacatggccacaatgatcgatatggtaatgttcgggaaaggtttggtcgttcacattttgctactagtcaaaacttcaacaaaactttgaaggccttgaacactatagcaccacttatgatgatcaaacctggatctgcagtgccctctaaaataagggaaagcacaaggttttacccctactttaaggattgtattggtgcaattgatggcacccatattccagcgatggtaaaaggtcgcgaagtaagcagttatcgtaatcgtcatggaattcagtctcaaaatgttttggcagcttgcaactttgatttgcaattcatatatgtgctaagtgggtgggaaggttcggcacatgattcaaaattgttaaatgatgccttattaaggagaaatggacttgaagttcctcaagtggattgtggatttgctaatcgacgccaattcttagctccgttacgaagtgttcgatatcatctcaaagattttggtggtcaaggtcgccatcctcgaaatgcaagtgacttgttcaatcttcgccatgcgtcattgaggaatgtgattgagagaatatttggtatctttaaatcacggttcacaattttcaaaaccgcacctccattcccatatcaaacacaagcagaattgatgttagcttgtgctggactacacaactttcttcgcacagaatgtcgtgaggatgaatttcctgttgaaccagaaaacgattcatcatctccatcctatctagatatggaagatgagaatcttgaactactttctcaaagtcaacaacgacaaagagcggaggctaatgcttggaggcttactattgctgaagctatgtgggaggatagaccgcgaaatgatgatgataatggaagtcaagagaataacaatgatactcaagacaatgagaatgagaataatgaggaacatatggatgacggggaacaagaaggttatgatgataatgaagttggaatggatgagtatgcagctttctaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DDE_Tnp_4

Protein Analysis

613

Amino Acids

70.42

Weight (kDa)

5.08

Isoelectric Point (pI)

54.44

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000697)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G35695
fragaria_vesca FvH4_4g17331 FvH4_6g20420 FvH4_6g24701 FvH4_6g52063
malus_domestica MD12G1024500.v1.1
prunus_persica Prupe.2G004900_v2.0.a1
pyrus_communis pycom10g09210 pycom111g03680 pycom12g13430 pycom16g19230
rosa_chinensis RchiOBHm_Chr5g0050651 RchiOBHm_Chr5g0054101 RchiOBHm_Chr6g0281391
rosa_multiflora Rmu_sc0000029.1_g000014 Rmu_sc0000147.1_g000039 Rmu_sc0000548.1_g000007 Rmu_sc0000913.1_g000001 Rmu_sc0000932.1_g000010 Rmu_sc0001304.1_g000041 Rmu_sc0001969.1_g000002 Rmu_sc0002357.1_g000042 Rmu_sc0002848.1_g000001 Rmu_sc0003113.1_g000003 Rmu_sc0003553.1_g000010 Rmu_sc0003642.1_g000003 Rmu_sc0004160.1_g000001 Rmu_sc0004511.1_g000001 Rmu_sc0004816.1_g000009 Rmu_sc0005500.1_g000008 Rmu_sc0005782.1_g000004 Rmu_sc0006833.1_g000005 Rmu_sc0007173.1_g000003 Rmu_sc0009973.1_g000001 Rmu_sc0016181.1_g000003 Rmu_sc0017974.1_g000001 Rmu_ssc0000255.1_g000020 Rmu_ssc0000263.1_g000011 Rmu_ssc0000366.1_g000012
rosa_roxburghii Rroxscaffold_1G00010110 Rroxscaffold_1G00023070 Rroxscaffold_1G00042980 Rroxscaffold_3G00273770 Rroxscaffold_4G00318480 Rroxscaffold_4G00323200 Rroxscaffold_5G00335150 Rroxscaffold_5G00340530 Rroxscaffold_5G00349500 Rroxscaffold_6G00401310 Rroxscaffold_6G00405610 Rroxscaffold_6G00409810 Rroxscaffold_7G00190250
rosa_rugosa Rorug04G0114300 Rorug05G0441600 Rorug07G0169600
rosa_wichuraiana Rw0G006340 Rw0G016280 Rw0G021420 Rw1G001890 Rw1G009310 Rw1G011130 Rw1G012600 Rw1G017460 Rw2G022560 Rw3G020960 Rw4G006850 Rw4G009950 Rw4G032810 Rw6G003640 Rw6G018030 Rw6G032240 Rw7G024530 Rw7G036060 Rw7G036830

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 1046
AccBSI CCGCTC 1 cut(s) 1640
AccII CGCG 2 cut(s) 1077, 1696
AciI CCGC 5 cut(s) 96, 416, 1446, 1640, 1694
AclWI GGATC 2 cut(s) 2, 976
AcoI YGGCCR 1 cut(s) 841
AcsI RAATTY 5 cut(s) 594, 674, 686, 1107, 1538
AcuI CTGAAG 1 cut(s) 1692
AcyI GRCGYC 1 cut(s) 1273
AfiI CCNNNNNNNGG 3 cut(s) 102, 217, 1221
AflII CTTAAG 2 cut(s) 130, 341
AhlI ACTAGT 1 cut(s) 899
AjnI CCWGG 1 cut(s) 964
AjuI GAANNNNNNNTTGG 2 cut(s) 384, 416
AloI GAACNNNNNNTCC 2 cut(s) 1224, 1256
AluBI AGCT 6 cut(s) 273, 1133, 1286, 1490, 1676, 1835
AluI AGCT 6 cut(s) 273, 1133, 1286, 1490, 1676, 1835
Alw26I GTCTC 2 cut(s) 741, 1119
AlwI GGATC 2 cut(s) 2, 976
AoxI GGCC 2 cut(s) 841, 927
ApeKI GCWGC 2 cut(s) 1130, 1832
ApoI RAATTY 5 cut(s) 594, 674, 686, 1107, 1538
AspLEI GCGC 1 cut(s) 360
AspS9I GGNCC 1 cut(s) 51
AsuHPI GGTGA 2 cut(s) 488, 567
AvaII GGWCC 1 cut(s) 51
BaeGI GKGCMC 1 cut(s) 981
BalI TGGCCA 1 cut(s) 843
BanI GGYRCC 1 cut(s) 1046
BarI GAAGNNNNNNTAC 2 cut(s) 141, 173
BbsI GAAGAC 1 cut(s) 507
BbvI GCAGC 1 cut(s) 1142
BceAI ACGGC 1 cut(s) 83
BciT130I CCWGG 1 cut(s) 966
BclI TGATCA 1 cut(s) 957
BcoDI GTCTC 2 cut(s) 741, 1119
BcuI ACTAGT 1 cut(s) 899
BfaI CTAG 3 cut(s) 276, 900, 1583
BfmI CTRYAG 2 cut(s) 939, 972
BfrI CTTAAG 2 cut(s) 130, 341
BisI GCNGC 3 cut(s) 96, 1131, 1833
BlsI GCNGC 3 cut(s) 97, 1132, 1834
Bme1390I CCNGG 1 cut(s) 966
Bme18I GGWCC 1 cut(s) 51
BmgT120I GGNCC 1 cut(s) 51
BmiI GGNNCC 2 cut(s) 606, 1048
BmrFI CCNGG 1 cut(s) 966
BmsI GCATC 6 cut(s) 82, 135, 445, 762, 784, 1201
BpiI GAAGAC 1 cut(s) 507
BpuEI CTTGAG 2 cut(s) 1230, 1725
Bsa29I ATCGAT 1 cut(s) 853
BsaBI GATNNNNATC 1 cut(s) 1599
BsaHI GRCGYC 1 cut(s) 1273
BsaJI CCNNGG 1 cut(s) 54
BsaXI ACNNNNNCTCC 2 cut(s) 1435, 1465
Bsc4I CCNNNNNNNGG 3 cut(s) 102, 217, 1221
Bse8I GATNNNNATC 1 cut(s) 1599
BseBI CCWGG 1 cut(s) 966
BseCI ATCGAT 1 cut(s) 853
BseDI CCNNGG 1 cut(s) 54
BseGI GGATG 7 cut(s) 113, 565, 1339, 1540, 1574, 1783, 1828
BseJI GATNNNNATC 1 cut(s) 1599
BseLI CCNNNNNNNGG 3 cut(s) 102, 217, 1221
BseSI GKGCMC 1 cut(s) 981
BseXI GCAGC 1 cut(s) 1142
Bsh1236I CGCG 2 cut(s) 1077, 1696
Bsh1285I CGRYCG 1 cut(s) 435
BshFI GGCC 2 cut(s) 843, 929
BshNI GGYRCC 1 cut(s) 1046
BshVI ATCGAT 1 cut(s) 853
BsiEI CGRYCG 1 cut(s) 435
BslFI GGGAC 1 cut(s) 379
BslI CCNNNNNNNGG 3 cut(s) 102, 217, 1221
BsmAI GTCTC 2 cut(s) 741, 1119
BsmFI GGGAC 1 cut(s) 379
BsnI GGCC 2 cut(s) 843, 929
Bsp1286I GDGCHC 1 cut(s) 981
Bsp143I GATC 4 cut(s) 7, 850, 957, 968
Bsp68I TCGCGA 1 cut(s) 1077
BspACI CCGC 5 cut(s) 96, 416, 1446, 1640, 1694
BspANI GGCC 2 cut(s) 843, 929
BspDI ATCGAT 1 cut(s) 853
BspFNI CGCG 2 cut(s) 1077, 1696
BspLI GGNNCC 2 cut(s) 606, 1048
BspMAI CTGCAG 1 cut(s) 976
BspPI GGATC 2 cut(s) 2, 976
BspT107I GGYRCC 1 cut(s) 1046
BspTI CTTAAG 2 cut(s) 130, 341
BsrBI CCGCTC 1 cut(s) 1640
BssECI CCNNGG 1 cut(s) 54
BssMI GATC 4 cut(s) 7, 850, 957, 968
BssNI GRCGYC 1 cut(s) 1273
BssT1I CCWWGG 1 cut(s) 54
Bst2UI CCWGG 1 cut(s) 966
Bst4CI ACNGT 2 cut(s) 145, 1428
Bst6I CTCTTC 3 cut(s) 54, 636, 675
BstACI GRCGYC 1 cut(s) 1273
BstAFI CTTAAG 2 cut(s) 130, 341
BstC8I GCNNGC 2 cut(s) 493, 1135
BstDEI CTNAG 3 cut(s) 816, 1166, 1282
BstENI CCTNNNNNAGG 1 cut(s) 1219
BstF5I GGATG 7 cut(s) 113, 565, 1339, 1540, 1574, 1783, 1828
BstFNI CGCG 2 cut(s) 1077, 1696
BstHHI GCGC 1 cut(s) 360
BstKTI GATC 4 cut(s) 10, 853, 960, 971
BstMAI GTCTC 2 cut(s) 741, 1119
BstMBI GATC 4 cut(s) 7, 850, 957, 968
BstMCI CGRYCG 1 cut(s) 435
BstMWI GCNNNNNNNGC 2 cut(s) 725, 1083
BstNI CCWGG 1 cut(s) 966
BstNSI RCATGY 1 cut(s) 495
BstSCI CCNGG 1 cut(s) 964
BstSFI CTRYAG 2 cut(s) 939, 972
BstSLI GKGCMC 1 cut(s) 981
BstUI CGCG 2 cut(s) 1077, 1696
BstV1I GCAGC 1 cut(s) 1142
BstV2I GAAGAC 1 cut(s) 507
BstX2I RGATCY 1 cut(s) 968
BstYI RGATCY 1 cut(s) 968
Bsu15I ATCGAT 1 cut(s) 853
BsuRI GGCC 2 cut(s) 843, 929
BsuTUI ATCGAT 1 cut(s) 853
BtgZI GCGATG 1 cut(s) 1076
BtsCI GGATG 7 cut(s) 113, 565, 1339, 1540, 1574, 1783, 1828
BtsI GCAGTG 2 cut(s) 53, 981
BtsIMutI CAGTG 3 cut(s) 53, 150, 981
BtuMI TCGCGA 1 cut(s) 1077
Cac8I GCNNGC 2 cut(s) 493, 1135
CfoI GCGC 1 cut(s) 360
Cfr13I GGNCC 1 cut(s) 51
ClaI ATCGAT 1 cut(s) 853
CseI GACGC 2 cut(s) 1281, 1368
CviAII CATG 5 cut(s) 492, 839, 1103, 1190, 1376
DdeI CTNAG 3 cut(s) 816, 1166, 1282
DpnI GATC 4 cut(s) 9, 852, 959, 970
DpnII GATC 4 cut(s) 7, 850, 957, 968
DraI TTTAAA 2 cut(s) 232, 1420
EaeI YGGCCR 1 cut(s) 841
Eam1104I CTCTTC 3 cut(s) 54, 636, 675
EarI CTCTTC 3 cut(s) 54, 636, 675
Eco130I CCWWGG 1 cut(s) 54
Eco147I AGGCCT 1 cut(s) 929
Eco32I GATATC 2 cut(s) 827, 1307
Eco47I GGWCC 1 cut(s) 51
Eco57I CTGAAG 1 cut(s) 1692
EcoNI CCTNNNNNAGG 1 cut(s) 1219
EcoRI GAATTC 1 cut(s) 1107
EcoRII CCWGG 1 cut(s) 964
EcoRV GATATC 2 cut(s) 827, 1307
EcoT14I CCWWGG 1 cut(s) 54
EcoT22I ATGCAT 2 cut(s) 497, 777
ErhI CCWWGG 1 cut(s) 54
FaeI CATG 5 cut(s) 495, 842, 1106, 1193, 1379
FaqI GGGAC 1 cut(s) 379
FatI CATG 5 cut(s) 491, 838, 1102, 1189, 1375
FauNDI CATATG 1 cut(s) 1773
FbaI TGATCA 1 cut(s) 957
Fnu4HI GCNGC 3 cut(s) 96, 1131, 1833
FokI GGATG 7 cut(s) 120, 552, 1326, 1547, 1561, 1790, 1835
Fsp4HI GCNGC 3 cut(s) 96, 1131, 1833
FspBI CTAG 3 cut(s) 276, 900, 1583
GlaI GCGC 1 cut(s) 359
GluI GCNGC 3 cut(s) 96, 1131, 1833
HaeIII GGCC 2 cut(s) 843, 929
HgaI GACGC 2 cut(s) 1281, 1368
HhaI GCGC 1 cut(s) 360
Hin1I GRCGYC 1 cut(s) 1273
Hin1II CATG 5 cut(s) 495, 842, 1106, 1193, 1379
Hin6I GCGC 1 cut(s) 358
HinP1I GCGC 1 cut(s) 358
HincII GTYRAC 1 cut(s) 1625
HindII GTYRAC 1 cut(s) 1625
HinfI GANTC 4 cut(s) 290, 1193, 1562, 1600
HphI GGTGA 2 cut(s) 488, 567
Hpy166II GTNNAC 5 cut(s) 51, 309, 887, 1431, 1625
Hpy188I TCNGA 1 cut(s) 609
Hpy188III TCNNGA 7 cut(s) 869, 1076, 1529, 1583, 1604, 1721, 1742
Hpy8I GTNNAC 5 cut(s) 51, 309, 887, 1431, 1625
Hpy99I CGWCG 2 cut(s) 807, 1275
HpyAV CCTTC 5 cut(s) 473, 614, 919, 1172, 1787
HpyCH4III ACNGT 2 cut(s) 145, 1428
HpyCH4IV ACGT 1 cut(s) 781
HpyF10VI GCNNNNNNNGC 2 cut(s) 725, 1083
HpyF3I CTNAG 3 cut(s) 816, 1166, 1282
HpySE526I ACGT 1 cut(s) 781
Hsp92I GRCGYC 1 cut(s) 1273
Hsp92II CATG 5 cut(s) 495, 842, 1106, 1193, 1379
HspAI GCGC 1 cut(s) 358
Ksp22I TGATCA 1 cut(s) 957
Kzo9I GATC 4 cut(s) 7, 850, 957, 968
LmnI GCTCC 1 cut(s) 1291
LpnPI CCDG 9 cut(s) 177, 202, 710, 951, 978, 1071, 1482, 1557, 1566
Lsp1109I GCAGC 1 cut(s) 1142
LweI GCATC 6 cut(s) 82, 135, 445, 762, 784, 1201
MaeI CTAG 3 cut(s) 276, 900, 1583
MaeII ACGT 1 cut(s) 781
MaeIII GTNAC 5 cut(s) 113, 188, 448, 1290, 1355
MalI GATC 4 cut(s) 9, 852, 959, 970
MbiI CCGCTC 1 cut(s) 1640
MboI GATC 4 cut(s) 7, 850, 957, 968
MfeI CAATTG 1 cut(s) 1038
MflI RGATCY 1 cut(s) 968
MhlI GDGCHC 1 cut(s) 981
MlsI TGGCCA 1 cut(s) 843
MluNI TGGCCA 1 cut(s) 843
MmeI TCCRAC 1 cut(s) 1795
Mox20I TGGCCA 1 cut(s) 843
Mph1103I ATGCAT 2 cut(s) 497, 777
MscI TGGCCA 1 cut(s) 843
MseI TTAA 9 cut(s) 131, 171, 231, 342, 743, 1020, 1205, 1220, 1419
MslI CAYNNNNRTG 2 cut(s) 1160, 1776
Msp20I TGGCCA 1 cut(s) 843
MspCI CTTAAG 2 cut(s) 130, 341
MspR9I CCNGG 1 cut(s) 966
MunI CAATTG 1 cut(s) 1038
MvaI CCWGG 1 cut(s) 966
MvnI CGCG 2 cut(s) 1077, 1696
MwoI GCNNNNNNNGC 2 cut(s) 725, 1083
NdeI CATATG 1 cut(s) 1773
NdeII GATC 4 cut(s) 7, 850, 957, 968
NlaIII CATG 5 cut(s) 495, 842, 1106, 1193, 1379
NlaIV GGNNCC 2 cut(s) 606, 1048
NmuCI GTSAC 3 cut(s) 113, 188, 1355
NruI TCGCGA 1 cut(s) 1077
NsiI ATGCAT 2 cut(s) 497, 777
NspI RCATGY 1 cut(s) 495
PaeI GCATGC 1 cut(s) 495
PceI AGGCCT 1 cut(s) 929
PcsI WCGNNNNNNNCGW 4 cut(s) 787, 802, 1300, 1342
PfeI GAWTC 4 cut(s) 290, 1193, 1562, 1600
PkrI GCNGC 3 cut(s) 97, 1132, 1834
Psp6I CCWGG 1 cut(s) 964
PspGI CCWGG 1 cut(s) 964
PspN4I GGNNCC 2 cut(s) 606, 1048
PspPI GGNCC 1 cut(s) 51
PstI CTGCAG 1 cut(s) 976
PsuI RGATCY 1 cut(s) 968
RruI TCGCGA 1 cut(s) 1077
RseI CAYNNNNRTG 2 cut(s) 1160, 1776
SaqAI TTAA 9 cut(s) 131, 171, 231, 342, 743, 1020, 1205, 1220, 1419
SatI GCNGC 3 cut(s) 96, 1131, 1833
Sau3AI GATC 4 cut(s) 7, 850, 957, 968
Sau96I GGNCC 1 cut(s) 51
ScrFI CCNGG 1 cut(s) 966
SduI GDGCHC 1 cut(s) 981
SfaNI GCATC 6 cut(s) 82, 135, 445, 762, 784, 1201
SfcI CTRYAG 2 cut(s) 939, 972
SinI GGWCC 1 cut(s) 51
SmiMI CAYNNNNRTG 2 cut(s) 1160, 1776
SmlI CTYRAG 4 cut(s) 130, 341, 1245, 1740
SmoI CTYRAG 4 cut(s) 130, 341, 1245, 1740
SpeI ACTAGT 1 cut(s) 899
SphI GCATGC 1 cut(s) 495
SseBI AGGCCT 1 cut(s) 929
SsiI CCGC 5 cut(s) 96, 416, 1446, 1640, 1694
SspI AATATT 1 cut(s) 1407
SspMI CTAG 3 cut(s) 276, 900, 1583
StuI AGGCCT 1 cut(s) 929
StyD4I CCNGG 1 cut(s) 964
StyI CCWWGG 1 cut(s) 54
TaaI ACNGT 2 cut(s) 145, 1428
TaiI ACGT 1 cut(s) 784
TaqI TCGA 5 cut(s) 238, 853, 1270, 1303, 1345
TaqII GACCGA 1 cut(s) 421
TauI GCSGC 1 cut(s) 98
TfiI GAWTC 4 cut(s) 290, 1193, 1562, 1600
Tru1I TTAA 9 cut(s) 131, 171, 231, 342, 743, 1020, 1205, 1220, 1419
Tru9I TTAA 9 cut(s) 131, 171, 231, 342, 743, 1020, 1205, 1220, 1419
TscAI CASTG 3 cut(s) 53, 150, 981
TseFI GTSAC 3 cut(s) 113, 188, 1355
TseI GCWGC 2 cut(s) 1130, 1832
Tsp45I GTSAC 3 cut(s) 113, 188, 1355
TspGWI ACGGA 1 cut(s) 1278
TspRI CASTG 3 cut(s) 53, 150, 981
Vha464I CTTAAG 2 cut(s) 130, 341
VpaK11BI GGWCC 1 cut(s) 51
XagI CCTNNNNNAGG 1 cut(s) 1219
XapI RAATTY 5 cut(s) 594, 674, 686, 1107, 1538
XbaI TCTAGA 1 cut(s) 1582
XceI RCATGY 1 cut(s) 495
XspI CTAG 3 cut(s) 276, 900, 1583
Zsp2I ATGCAT 2 cut(s) 497, 777
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.