pycom14g00050

transposition, RNA-mediated

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr14
Physical Location & Seq
Forward (+)
44270 .. 44697
428 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 387 bp
ATGGCTGAAGAAAGCTTAGTAAATTTGGAAGGAGACGGCTTTCATGCTACTCCACCATCACCACACTCAGATATTGATATCAACCCAAATCAACGTCTTAGTTCTGTCTTGCTAAATGAGTTTAACTATCTTCCATGGGAGAGAGCAGTTTCTCTTGCTCTGGGAGGACGATCAAAGCTTGGTTATGTTAATGGTGCTATTCCAATGCCTGAGACTACCTCACCGGAGTATGATGCTTGGCTATGCAAAGACCAGTTGGTCATGTCGTGGCTACTCAATTCCATGGATCGTAAGATTGCAGAAATTTTTAGCTATGCTGAATCCTCCATGACTCTTTGGAAAAATCTCAAGGAAATCAGAACAATGCGGCTAGAGTGTTTCAGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

129

Amino Acids

14.53

Weight (kDa)

4.83

Isoelectric Point (pI)

50.98

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Retrotran_gag_3 PF14244 31 - 70 8.6e-13 gag-polypeptide of LTR copia-type
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000562)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g17331 FvH4_3g36541
malus_domestica MD07G1078600.v1.1 MD10G1237700.v1.1 MD10G1333400.v1.1 MD11G1102200.v1.1 MD13G1138400.v1.1 MD14G1033400.v1.1 MD15G1053300.v1.1
prunus_persica Prupe.1G465400_v2.0.a1 Prupe.3G136000_v2.0.a1 Prupe.7G119900_v2.0.a1
pyrus_communis pycom01g04630 pycom03g13050 pycom04g21190 pycom05g04910 pycom05g05510 pycom08g15850 pycom09g15040 pycom1094g00010 pycom11g02000 pycom12g06150 pycom13g24110 pycom13g24910 pycom14g00050 pycom15g21970 pycom15g35170 pycom15g35180 pycom16g14620 pycom16g14630 pycom808g00110
rosa_chinensis RchiOBHm_Chr1g0322851 RchiOBHm_Chr1g0365941 RchiOBHm_Chr3g0453341 RchiOBHm_Chr4g0388371 RchiOBHm_Chr4g0394021 RchiOBHm_Chr5g0013181 RchiOBHm_Chr6g0261721 RchiOBHm_Chr6g0261731 RchiOBHm_Chr7g0188861 RchiOBHm_Chr7g0192331 RchiOBHm_Chr7g0231721
rosa_multiflora Rmu_sc0002521.1_g000006 Rmu_sc0003255.1_g000026 Rmu_sc0004191.1_g000036 Rmu_sc0004414.1_g000014 Rmu_sc0005670.1_g000006 Rmu_sc0006081.1_g000001 Rmu_sc0007215.1_g000004 Rmu_sc0010088.1_g000010 Rmu_sc0020285.1_g000003 Rmu_sc0026896.1_g000002 Rmu_ssc0000019.1_g000029
rosa_roxburghii Rroxscaffold_3G00224890 Rroxscaffold_6G00400640 Rroxscaffold_7G00176590 Rroxscaffold_7G00189230
rosa_samantha Rh4BG046700
rosa_wichuraiana Rw1G012690 Rw1G031370 Rw2G042180 Rw2G043670 Rw2G046240 Rw2G049890 Rw2G050760 Rw2G051280 Rw2G053590 Rw3G007590 Rw3G026850 Rw4G001540 Rw4G009760 Rw4G019270 Rw5G000720 Rw5G005620 Rw5G041560 Rw6G007370 Rw6G009830 Rw6G015360 Rw6G031160 Rw7G004930 Rw7G011010 Rw7G024230 Rw7G028240

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 257
AciI CCGC 1 cut(s) 367
AclWI GGATC 1 cut(s) 294
AcsI RAATTY 2 cut(s) 22, 303
AcuI CTGAAG 1 cut(s) 27
AluBI AGCT 3 cut(s) 15, 178, 312
AluI AGCT 3 cut(s) 15, 178, 312
Alw26I GTCTC 2 cut(s) 27, 206
AlwI GGATC 1 cut(s) 294
ApoI RAATTY 2 cut(s) 22, 303
AsuHPI GGTGA 2 cut(s) 51, 213
BccI CCATC 1 cut(s) 64
BceAI ACGGC 1 cut(s) 52
BcoDI GTCTC 2 cut(s) 27, 206
BfaI CTAG 1 cut(s) 371
BisI GCNGC 1 cut(s) 368
BlsI GCNGC 1 cut(s) 369
BmsI GCATC 1 cut(s) 223
BplI GAGNNNNNCTC 2 cut(s) 203, 235
BpuEI CTTGAG 1 cut(s) 332
BsaJI CCNNGG 2 cut(s) 134, 282
BsaWI WCCGGW 1 cut(s) 223
Bse1I ACTGG 1 cut(s) 253
BseDI CCNNGG 2 cut(s) 134, 282
BseMII CTCAG 2 cut(s) 81, 201
BseNI ACTGG 1 cut(s) 253
BsiSI CCGG 1 cut(s) 224
BsmAI GTCTC 2 cut(s) 27, 206
BsmBI CGTCTC 1 cut(s) 27
Bsp143I GATC 2 cut(s) 170, 286
Bsp19I CCATGG 2 cut(s) 134, 282
BspACI CCGC 1 cut(s) 367
BspCNI CTCAG 2 cut(s) 80, 202
BspPI GGATC 1 cut(s) 294
BsrI ACTGG 1 cut(s) 253
BssECI CCNNGG 2 cut(s) 134, 282
BssMI GATC 2 cut(s) 170, 286
BssT1I CCWWGG 2 cut(s) 134, 282
BstDEI CTNAG 4 cut(s) 16, 67, 98, 210
BstDSI CCRYGG 2 cut(s) 134, 282
BstKTI GATC 2 cut(s) 173, 289
BstMAI GTCTC 2 cut(s) 27, 206
BstMBI GATC 2 cut(s) 170, 286
BtgI CCRYGG 2 cut(s) 134, 282
CviAII CATG 5 cut(s) 44, 135, 262, 283, 328
CviJI RGCY 8 cut(s) 5, 15, 39, 178, 241, 271, 312, 370
CviKI_1 RGCY 8 cut(s) 5, 15, 39, 178, 241, 271, 312, 370
DdeI CTNAG 4 cut(s) 16, 67, 98, 210
DpnI GATC 2 cut(s) 172, 288
DpnII GATC 2 cut(s) 170, 286
DrdI GACNNNNNNGTC 1 cut(s) 257
DseDI GACNNNNNNGTC 1 cut(s) 257
Eco130I CCWWGG 2 cut(s) 134, 282
Eco32I GATATC 1 cut(s) 79
Eco57I CTGAAG 1 cut(s) 27
EcoRV GATATC 1 cut(s) 79
EcoT14I CCWWGG 2 cut(s) 134, 282
ErhI CCWWGG 2 cut(s) 134, 282
Esp3I CGTCTC 1 cut(s) 27
FaeI CATG 5 cut(s) 47, 138, 265, 286, 331
FaiI YATR 9 cut(s) 45, 136, 186, 231, 244, 263, 284, 315, 329
FatI CATG 5 cut(s) 43, 134, 261, 282, 327
Fnu4HI GCNGC 1 cut(s) 368
Fsp4HI GCNGC 1 cut(s) 368
FspBI CTAG 1 cut(s) 371
GluI GCNGC 1 cut(s) 368
HapII CCGG 1 cut(s) 224
Hin1II CATG 5 cut(s) 47, 138, 265, 286, 331
HindIII AAGCTT 2 cut(s) 13, 176
HinfI GANTC 2 cut(s) 320, 331
HpaII CCGG 1 cut(s) 224
HphI GGTGA 2 cut(s) 51, 213
Hpy188I TCNGA 2 cut(s) 70, 359
HpyAV CCTTC 1 cut(s) 23
HpyCH4IV ACGT 1 cut(s) 94
HpyCH4V TGCA 2 cut(s) 246, 299
HpyF3I CTNAG 4 cut(s) 16, 67, 98, 210
HpySE526I ACGT 1 cut(s) 94
Hsp92II CATG 5 cut(s) 47, 138, 265, 286, 331
Kzo9I GATC 2 cut(s) 170, 286
LpnPI CCDG 4 cut(s) 146, 222, 237, 266
LweI GCATC 1 cut(s) 223
MaeI CTAG 1 cut(s) 371
MaeII ACGT 1 cut(s) 94
MalI GATC 2 cut(s) 172, 288
MboI GATC 2 cut(s) 170, 286
MboII GAAGA 2 cut(s) 20, 122
MluCI AATT 3 cut(s) 22, 277, 303
MlyI GAGTC 1 cut(s) 325
MnlI CCTC 3 cut(s) 158, 229, 334
MseI TTAA 3 cut(s) 123, 189, 385
MspI CCGG 1 cut(s) 224
NcoI CCATGG 2 cut(s) 134, 282
NdeII GATC 2 cut(s) 170, 286
NlaIII CATG 5 cut(s) 47, 138, 265, 286, 331
PfeI GAWTC 1 cut(s) 320
PkrI GCNGC 1 cut(s) 369
PleI GAGTC 1 cut(s) 325
PpsI GAGTC 1 cut(s) 325
SaqAI TTAA 3 cut(s) 123, 189, 385
SatI GCNGC 1 cut(s) 368
Sau3AI GATC 2 cut(s) 170, 286
SchI GAGTC 1 cut(s) 325
SetI ASST 5 cut(s) 17, 97, 180, 221, 314
SfaNI GCATC 1 cut(s) 223
SmlI CTYRAG 1 cut(s) 347
SmoI CTYRAG 1 cut(s) 347
Sse9I AATT 3 cut(s) 22, 277, 303
SsiI CCGC 1 cut(s) 367
SspMI CTAG 1 cut(s) 371
StyI CCWWGG 2 cut(s) 134, 282
TaiI ACGT 1 cut(s) 97
TasI AATT 3 cut(s) 22, 277, 303
TauI GCSGC 1 cut(s) 370
TfiI GAWTC 1 cut(s) 320
Tru1I TTAA 3 cut(s) 123, 189, 385
Tru9I TTAA 3 cut(s) 123, 189, 385
TspDTI ATGAA 1 cut(s) 32
XapI RAATTY 2 cut(s) 22, 303
XspI CTAG 1 cut(s) 371
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.