pycom16g14630

transposition, RNA-mediated

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr16
Physical Location & Seq
Forward (+)
10713498 .. 10713953
456 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 456 bp
ATGTATGGCAGCCAAAACAATGTTGCACGGGTCTTCCAATTAAAGAAGGACATCTCCGATCTGCAGCAAGATGGCAAACCGTTTGTGCAACTCCTAGGAAGCATGAAAAGCATGTGGAATGAGTTGGAAATCTATCGCCCTCACACAACCGACGCAGCACTGCTACGAAAGAGAGCAGAAGAAGACAAGATATTTCAACTCTTGTCTAGTCTTGATTCAACGTATGAAGATCTTCGATGTCACATACTCATGAACACTGAGCTTCCTTCTTTCACCAGTATGTGTGCGACGATTCAACGAGAAGAAGTAAGAAGGAAAGTTATGAACATAGGTACAACGACCAGTGTACCTGAGGCTAAGGCATATATAACCAACGAAAAGAGGTACAAAGGAAAACATTCGAACTTGAAATGTCAACACTGCAATAATATAGGTCACGTCAAAGACACATGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

152

Amino Acids

17.41

Weight (kDa)

8.8

Isoelectric Point (pI)

48.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000562)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g17331 FvH4_3g36541
malus_domestica MD07G1078600.v1.1 MD10G1237700.v1.1 MD10G1333400.v1.1 MD11G1102200.v1.1 MD13G1138400.v1.1 MD14G1033400.v1.1 MD15G1053300.v1.1
prunus_persica Prupe.1G465400_v2.0.a1 Prupe.3G136000_v2.0.a1 Prupe.7G119900_v2.0.a1
pyrus_communis pycom01g04630 pycom03g13050 pycom04g21190 pycom05g04910 pycom05g05510 pycom08g15850 pycom09g15040 pycom1094g00010 pycom11g02000 pycom12g06150 pycom13g24110 pycom13g24910 pycom14g00050 pycom15g21970 pycom15g35170 pycom15g35180 pycom16g14620 pycom16g14630 pycom808g00110
rosa_chinensis RchiOBHm_Chr1g0322851 RchiOBHm_Chr1g0365941 RchiOBHm_Chr3g0453341 RchiOBHm_Chr4g0388371 RchiOBHm_Chr4g0394021 RchiOBHm_Chr5g0013181 RchiOBHm_Chr6g0261721 RchiOBHm_Chr6g0261731 RchiOBHm_Chr7g0188861 RchiOBHm_Chr7g0192331 RchiOBHm_Chr7g0231721
rosa_multiflora Rmu_sc0002521.1_g000006 Rmu_sc0003255.1_g000026 Rmu_sc0004191.1_g000036 Rmu_sc0004414.1_g000014 Rmu_sc0005670.1_g000006 Rmu_sc0006081.1_g000001 Rmu_sc0007215.1_g000004 Rmu_sc0010088.1_g000010 Rmu_sc0020285.1_g000003 Rmu_sc0026896.1_g000002 Rmu_ssc0000019.1_g000029
rosa_roxburghii Rroxscaffold_3G00224890 Rroxscaffold_6G00400640 Rroxscaffold_7G00176590 Rroxscaffold_7G00189230
rosa_samantha Rh4BG046700
rosa_wichuraiana Rw1G012690 Rw1G031370 Rw2G042180 Rw2G043670 Rw2G046240 Rw2G049890 Rw2G050760 Rw2G051280 Rw2G053590 Rw3G007590 Rw3G026850 Rw4G001540 Rw4G009760 Rw4G019270 Rw5G000720 Rw5G005620 Rw5G041560 Rw6G007370 Rw6G009830 Rw6G015360 Rw6G031160 Rw7G004930 Rw7G011010 Rw7G024230 Rw7G028240

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 3 cut(s) 334, 348, 386
AgsI TTSAA 4 cut(s) 197, 219, 296, 409
AjiI CACGTC 1 cut(s) 439
AluBI AGCT 1 cut(s) 262
AluI AGCT 1 cut(s) 262
ApeKI GCWGC 3 cut(s) 9, 64, 155
Asp700I GAANNNNTTC 2 cut(s) 231, 397
AspA2I CCTAGG 1 cut(s) 94
AsuHPI GGTGA 1 cut(s) 265
AsuII TTCGAA 1 cut(s) 401
AvrII CCTAGG 1 cut(s) 94
AxyI CCTNAGG 1 cut(s) 351
BaeI ACNNNNGTAYC 2 cut(s) 330, 363
BbsI GAAGAC 2 cut(s) 25, 189
BbvI GCAGC 3 cut(s) 21, 76, 167
BccI CCATC 1 cut(s) 65
BfaI CTAG 3 cut(s) 95, 207, 454
BfmI CTRYAG 1 cut(s) 62
BglII AGATCT 1 cut(s) 229
BisI GCNGC 3 cut(s) 10, 65, 156
BlnI CCTAGG 1 cut(s) 94
BlsI GCNGC 3 cut(s) 11, 66, 157
BmgBI CACGTC 1 cut(s) 439
BpiI GAAGAC 2 cut(s) 25, 189
Bpu10I CCTNAGC 1 cut(s) 357
Bpu14I TTCGAA 1 cut(s) 401
BsaJI CCNNGG 1 cut(s) 94
Bse1I ACTGG 2 cut(s) 276, 342
Bse21I CCTNAGG 1 cut(s) 351
BseDI CCNNGG 1 cut(s) 94
BseMII CTCAG 2 cut(s) 249, 342
BseNI ACTGG 2 cut(s) 276, 342
BseXI GCAGC 3 cut(s) 21, 76, 167
Bsp119I TTCGAA 1 cut(s) 401
Bsp143I GATC 2 cut(s) 58, 229
BspCNI CTCAG 2 cut(s) 250, 343
BspHI TCATGA 1 cut(s) 249
BspMAI CTGCAG 1 cut(s) 66
BspT104I TTCGAA 1 cut(s) 401
BsrI ACTGG 2 cut(s) 276, 342
BssECI CCNNGG 1 cut(s) 94
BssMI GATC 2 cut(s) 58, 229
BssT1I CCWWGG 1 cut(s) 94
Bst4CI ACNGT 1 cut(s) 81
BstBI TTCGAA 1 cut(s) 401
BstDEI CTNAG 3 cut(s) 258, 351, 357
BstKTI GATC 2 cut(s) 61, 232
BstMBI GATC 2 cut(s) 58, 229
BstMWI GCNNNNNNNGC 1 cut(s) 108
BstNSI RCATGY 2 cut(s) 115, 453
BstSFI CTRYAG 1 cut(s) 62
BstV1I GCAGC 3 cut(s) 21, 76, 167
BstV2I GAAGAC 2 cut(s) 25, 189
BstX2I RGATCY 1 cut(s) 229
BstYI RGATCY 1 cut(s) 229
Bsu36I CCTNAGG 1 cut(s) 351
BtrI CACGTC 1 cut(s) 439
BtsI GCAGTG 2 cut(s) 158, 418
BtsIMutI CAGTG 4 cut(s) 158, 255, 349, 418
CciI TCATGA 1 cut(s) 249
CseI GACGC 1 cut(s) 161
Csp6I GTAC 3 cut(s) 333, 347, 385
CviAII CATG 4 cut(s) 103, 112, 250, 450
CviJI RGCY 3 cut(s) 12, 262, 356
CviKI_1 RGCY 3 cut(s) 12, 262, 356
CviQI GTAC 3 cut(s) 333, 347, 385
DdeI CTNAG 3 cut(s) 258, 351, 357
DpnI GATC 2 cut(s) 60, 231
DpnII GATC 2 cut(s) 58, 229
Eco130I CCWWGG 1 cut(s) 94
Eco81I CCTNAGG 1 cut(s) 351
EcoT14I CCWWGG 1 cut(s) 94
ErhI CCWWGG 1 cut(s) 94
FaeI CATG 4 cut(s) 106, 115, 253, 453
FatI CATG 4 cut(s) 102, 111, 249, 449
Fnu4HI GCNGC 3 cut(s) 10, 65, 156
Fsp4HI GCNGC 3 cut(s) 10, 65, 156
FspBI CTAG 3 cut(s) 95, 207, 454
GluI GCNGC 3 cut(s) 10, 65, 156
HgaI GACGC 1 cut(s) 161
Hin1II CATG 4 cut(s) 106, 115, 253, 453
HincII GTYRAC 1 cut(s) 416
HindII GTYRAC 1 cut(s) 416
HinfI GANTC 2 cut(s) 215, 292
HphI GGTGA 1 cut(s) 265
Hpy166II GTNNAC 2 cut(s) 347, 416
Hpy188I TCNGA 1 cut(s) 58
Hpy188III TCNNGA 2 cut(s) 212, 250
Hpy8I GTNNAC 2 cut(s) 347, 416
Hpy99I CGWCG 2 cut(s) 155, 292
HpyAV CCTTC 3 cut(s) 40, 276, 306
HpyCH4III ACNGT 1 cut(s) 81
HpyCH4IV ACGT 2 cut(s) 221, 438
HpyCH4V TGCA 4 cut(s) 26, 64, 88, 423
HpyF10VI GCNNNNNNNGC 1 cut(s) 108
HpyF3I CTNAG 3 cut(s) 258, 351, 357
HpySE526I ACGT 2 cut(s) 221, 438
Hsp92II CATG 4 cut(s) 106, 115, 253, 453
Kzo9I GATC 2 cut(s) 58, 229
LpnPI CCDG 3 cut(s) 289, 355, 363
Lsp1109I GCAGC 3 cut(s) 21, 76, 167
MaeI CTAG 3 cut(s) 95, 207, 454
MaeII ACGT 2 cut(s) 221, 438
MaeIII GTNAC 2 cut(s) 239, 434
MalI GATC 2 cut(s) 60, 231
MboI GATC 2 cut(s) 58, 229
MboII GAAGA 6 cut(s) 25, 191, 194, 224, 239, 314
MflI RGATCY 1 cut(s) 229
MluCI AATT 1 cut(s) 38
MmeI TCCRAC 1 cut(s) 105
MnlI CCTC 3 cut(s) 150, 346, 375
MroXI GAANNNNTTC 2 cut(s) 231, 397
MseI TTAA 1 cut(s) 41
MslI CAYNNNNRTG 2 cut(s) 248, 278
MwoI GCNNNNNNNGC 1 cut(s) 108
NdeII GATC 2 cut(s) 58, 229
NlaIII CATG 4 cut(s) 106, 115, 253, 453
NmuCI GTSAC 2 cut(s) 239, 434
NspI RCATGY 2 cut(s) 115, 453
NspV TTCGAA 1 cut(s) 401
PagI TCATGA 1 cut(s) 249
PdmI GAANNNNTTC 2 cut(s) 231, 397
PfeI GAWTC 2 cut(s) 215, 292
PkrI GCNGC 3 cut(s) 11, 66, 157
PstI CTGCAG 1 cut(s) 66
PsuI RGATCY 1 cut(s) 229
RsaI GTAC 3 cut(s) 334, 348, 386
RsaNI GTAC 3 cut(s) 333, 347, 385
RseI CAYNNNNRTG 2 cut(s) 248, 278
SaqAI TTAA 1 cut(s) 41
SatI GCNGC 3 cut(s) 10, 65, 156
Sau3AI GATC 2 cut(s) 58, 229
SetI ASST 7 cut(s) 224, 264, 334, 352, 386, 436, 441
SfcI CTRYAG 1 cut(s) 62
SfuI TTCGAA 1 cut(s) 401
SmiMI CAYNNNNRTG 2 cut(s) 248, 278
Sse9I AATT 1 cut(s) 38
SspMI CTAG 3 cut(s) 95, 207, 454
StyI CCWWGG 1 cut(s) 94
TaaI ACNGT 1 cut(s) 81
TaiI ACGT 2 cut(s) 224, 441
TaqI TCGA 2 cut(s) 235, 401
TasI AATT 1 cut(s) 38
TfiI GAWTC 2 cut(s) 215, 292
Tru1I TTAA 1 cut(s) 41
Tru9I TTAA 1 cut(s) 41
TscAI CASTG 4 cut(s) 165, 262, 349, 425
TseFI GTSAC 2 cut(s) 239, 434
TseI GCWGC 3 cut(s) 9, 64, 155
Tsp45I GTSAC 2 cut(s) 239, 434
TspDTI ATGAA 4 cut(s) 119, 240, 266, 338
TspRI CASTG 4 cut(s) 165, 262, 349, 425
XceI RCATGY 2 cut(s) 115, 453
XmaJI CCTAGG 1 cut(s) 94
XmnI GAANNNNTTC 2 cut(s) 231, 397
XspI CTAG 3 cut(s) 95, 207, 454
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.