RchiOBHm_Chr4g0413661

WD40 repeats

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Forward (+)
37926957 .. 37929454
2498 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ38416

Sequence Viewer

Length: 390 bp
ATGGCAAGAACTTGGGATTATAGGTCTAAAAACTATGTTCCATATCAGGTATATAGAGTTTCTGATATGGAACTTGTGAGAATTCTCCCTAGTGCAGAAGATGAGGTCAACGTAGCTTGTTTTCATCCCTCTGTAGGAGGTGGCCTTGTTTATGGAACTAAGGAAGGGAAGTTAAGGATCCTCCAATATGATAGTTCTCATGTCGTGGGTCATACAACTTCCAATTTTCTTAATGAAAACATGCTAGCTAGAGGTCCCAACTTATGCTTTAGAATGCTAGGGACTAGCTGCCATTATCCACTTGTGGGATGTACCGCTCAGCTTAGATGGATCAAATCATGTTGTACTCATGAAGCTTGTCGCAGAATTACACCATATTTATACCTATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

129

Amino Acids

14.74

Weight (kDa)

8.71

Isoelectric Point (pI)

55.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 317
AciI CCGC 1 cut(s) 315
AclWI GGATC 3 cut(s) 172, 185, 338
AcsI RAATTY 1 cut(s) 81
AfaI GTAC 2 cut(s) 313, 346
AfiI CCNNNNNNNGG 2 cut(s) 134, 305
AluBI AGCT 5 cut(s) 116, 248, 288, 322, 356
AluI AGCT 5 cut(s) 116, 248, 288, 322, 356
AlwI GGATC 3 cut(s) 172, 185, 338
AoxI GGCC 1 cut(s) 142
ApeKI GCWGC 1 cut(s) 288
ApoI RAATTY 1 cut(s) 81
AspS9I GGNCC 1 cut(s) 254
AsuNHI GCTAGC 1 cut(s) 244
AvaII GGWCC 1 cut(s) 254
BamHI GGATCC 1 cut(s) 177
BbvI GCAGC 1 cut(s) 275
BccI CCATC 1 cut(s) 321
BfaI CTAG 5 cut(s) 90, 245, 249, 278, 285
BfmI CTRYAG 2 cut(s) 132, 386
BisI GCNGC 1 cut(s) 289
BlpI GCTNAGC 1 cut(s) 318
BlsI GCNGC 1 cut(s) 290
Bme18I GGWCC 1 cut(s) 254
BmgT120I GGNCC 1 cut(s) 254
BmiI GGNNCC 2 cut(s) 179, 256
BmtI GCTAGC 1 cut(s) 248
Bpu1102I GCTNAGC 1 cut(s) 318
Bsc4I CCNNNNNNNGG 2 cut(s) 134, 305
BseGI GGATG 2 cut(s) 124, 314
BseLI CCNNNNNNNGG 2 cut(s) 134, 305
BseMII CTCAG 1 cut(s) 332
BseXI GCAGC 1 cut(s) 275
BsgI GTGCAG 1 cut(s) 114
BshFI GGCC 1 cut(s) 144
BslFI GGGAC 2 cut(s) 240, 295
BslI CCNNNNNNNGG 2 cut(s) 134, 305
BsmFI GGGAC 2 cut(s) 240, 295
BsmI GAATGC 1 cut(s) 279
BsnI GGCC 1 cut(s) 144
Bsp143I GATC 2 cut(s) 177, 330
Bsp1720I GCTNAGC 1 cut(s) 318
BspACI CCGC 1 cut(s) 315
BspANI GGCC 1 cut(s) 144
BspCNI CTCAG 1 cut(s) 331
BspHI TCATGA 1 cut(s) 349
BspLI GGNNCC 2 cut(s) 179, 256
BspOI GCTAGC 1 cut(s) 248
BspPI GGATC 3 cut(s) 172, 185, 338
BsrBI CCGCTC 1 cut(s) 317
BssMI GATC 2 cut(s) 177, 330
BstC8I GCNNGC 1 cut(s) 246
BstDEI CTNAG 3 cut(s) 159, 318, 323
BstF5I GGATG 2 cut(s) 124, 314
BstKTI GATC 2 cut(s) 180, 333
BstMBI GATC 2 cut(s) 177, 330
BstNSI RCATGY 1 cut(s) 244
BstSFI CTRYAG 2 cut(s) 132, 386
BstV1I GCAGC 1 cut(s) 275
BstX2I RGATCY 1 cut(s) 177
BstYI RGATCY 1 cut(s) 177
BsuRI GGCC 1 cut(s) 144
BtsCI GGATG 2 cut(s) 124, 314
Cac8I GCNNGC 1 cut(s) 246
CciI TCATGA 1 cut(s) 349
Cfr13I GGNCC 1 cut(s) 254
Csp6I GTAC 2 cut(s) 312, 345
CviAII CATG 4 cut(s) 200, 241, 339, 350
CviJI RGCY 6 cut(s) 116, 144, 248, 288, 322, 356
CviKI_1 RGCY 6 cut(s) 116, 144, 248, 288, 322, 356
CviQI GTAC 2 cut(s) 312, 345
DdeI CTNAG 3 cut(s) 159, 318, 323
DpnI GATC 2 cut(s) 179, 332
DpnII GATC 2 cut(s) 177, 330
Eco47I GGWCC 1 cut(s) 254
EcoO109I RGGNCCY 1 cut(s) 254
EcoRI GAATTC 1 cut(s) 81
FaeI CATG 4 cut(s) 203, 244, 342, 353
FaqI GGGAC 2 cut(s) 240, 295
FatI CATG 4 cut(s) 199, 240, 338, 349
Fnu4HI GCNGC 1 cut(s) 289
FokI GGATG 2 cut(s) 111, 321
Fsp4HI GCNGC 1 cut(s) 289
FspBI CTAG 5 cut(s) 90, 245, 249, 278, 285
GluI GCNGC 1 cut(s) 289
HaeIII GGCC 1 cut(s) 144
Hin1II CATG 4 cut(s) 203, 244, 342, 353
HincII GTYRAC 1 cut(s) 109
HindII GTYRAC 1 cut(s) 109
HindIII AAGCTT 1 cut(s) 354
Hpy166II GTNNAC 1 cut(s) 109
Hpy188I TCNGA 1 cut(s) 64
Hpy188III TCNNGA 1 cut(s) 350
Hpy8I GTNNAC 1 cut(s) 109
HpyAV CCTTC 1 cut(s) 158
HpyCH4IV ACGT 1 cut(s) 111
HpyCH4V TGCA 1 cut(s) 95
HpyF3I CTNAG 3 cut(s) 159, 318, 323
HpySE526I ACGT 1 cut(s) 111
Hsp92II CATG 4 cut(s) 203, 244, 342, 353
Kzo9I GATC 2 cut(s) 177, 330
LpnPI CCDG 1 cut(s) 32
Lsp1109I GCAGC 1 cut(s) 275
MaeI CTAG 5 cut(s) 90, 245, 249, 278, 285
MaeII ACGT 1 cut(s) 111
MalI GATC 2 cut(s) 179, 332
MbiI CCGCTC 1 cut(s) 317
MboI GATC 2 cut(s) 177, 330
MboII GAAGA 1 cut(s) 110
MflI RGATCY 1 cut(s) 177
MluCI AATT 3 cut(s) 81, 223, 366
MnlI CCTC 5 cut(s) 97, 131, 139, 191, 245
MseI TTAA 2 cut(s) 173, 231
Mva1269I GAATGC 1 cut(s) 279
NdeII GATC 2 cut(s) 177, 330
NheI GCTAGC 1 cut(s) 244
NlaIII CATG 4 cut(s) 203, 244, 342, 353
NlaIV GGNNCC 2 cut(s) 179, 256
NspI RCATGY 1 cut(s) 244
PagI TCATGA 1 cut(s) 349
PctI GAATGC 1 cut(s) 279
PkrI GCNGC 1 cut(s) 290
PpuMI RGGWCCY 1 cut(s) 254
Psp5II RGGWCCY 1 cut(s) 254
PspN4I GGNNCC 2 cut(s) 179, 256
PspPI GGNCC 1 cut(s) 254
PspPPI RGGWCCY 1 cut(s) 254
PsuI RGATCY 1 cut(s) 177
RsaI GTAC 2 cut(s) 313, 346
RsaNI GTAC 2 cut(s) 312, 345
SaqAI TTAA 2 cut(s) 173, 231
SatI GCNGC 1 cut(s) 289
Sau3AI GATC 2 cut(s) 177, 330
Sau96I GGNCC 1 cut(s) 254
SfcI CTRYAG 2 cut(s) 132, 386
SinI GGWCC 1 cut(s) 254
Sse9I AATT 3 cut(s) 81, 223, 366
SsiI CCGC 1 cut(s) 315
SspMI CTAG 5 cut(s) 90, 245, 249, 278, 285
TaiI ACGT 1 cut(s) 114
TasI AATT 3 cut(s) 81, 223, 366
TatI WGTACW 1 cut(s) 344
Tru1I TTAA 2 cut(s) 173, 231
Tru9I TTAA 2 cut(s) 173, 231
TseI GCWGC 1 cut(s) 288
TspDTI ATGAA 3 cut(s) 113, 249, 366
VpaK11BI GGWCC 1 cut(s) 254
XapI RAATTY 1 cut(s) 81
XceI RCATGY 1 cut(s) 244
XspI CTAG 5 cut(s) 90, 245, 249, 278, 285
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.