Rh4CG192700

WD40 repeats

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
Physical Location & Seq
Forward (+)
41393452 .. 41394536
1085 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG192700.1

Sequence Viewer

Length: 297 bp
ATGGAACTTGTGAGAATTCTCCCTAGTGCAGAAGATGAGGTCAACGTAGCTTGTTTTCATCCCTCTGTAGGAGGTGGCCTTGTTTATGGAACTAAGGAAGGGAAGTTAAGGATCCTCCAATATGATAGTTCTCATGTCGTGGGTCATACAACTTCCAATTTTCTTAATGAAAACATGCTAGCTAGAGGTCCCAACTTATGCTTTAGAATGCTAGGGACTAGCTGCCATTATCCACTTGTGGGATGTACCGCTCAGCTTAGATGGTTTCTTTCTCTTCTTAAATATCTATTATTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

98

Amino Acids

10.95

Weight (kDa)

7.72

Isoelectric Point (pI)

51.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 251
AciI CCGC 1 cut(s) 249
AclWI GGATC 2 cut(s) 106, 119
AcsI RAATTY 1 cut(s) 15
AfaI GTAC 1 cut(s) 247
AfiI CCNNNNNNNGG 2 cut(s) 68, 239
AluBI AGCT 4 cut(s) 50, 182, 222, 256
AluI AGCT 4 cut(s) 50, 182, 222, 256
AlwI GGATC 2 cut(s) 106, 119
AoxI GGCC 1 cut(s) 76
ApeKI GCWGC 1 cut(s) 222
ApoI RAATTY 1 cut(s) 15
AspS9I GGNCC 1 cut(s) 188
AsuNHI GCTAGC 1 cut(s) 178
AvaII GGWCC 1 cut(s) 188
BamHI GGATCC 1 cut(s) 111
BbvI GCAGC 1 cut(s) 209
BccI CCATC 1 cut(s) 255
BfaI CTAG 5 cut(s) 24, 179, 183, 212, 219
BfmI CTRYAG 1 cut(s) 66
BisI GCNGC 1 cut(s) 223
BlpI GCTNAGC 1 cut(s) 252
BlsI GCNGC 1 cut(s) 224
Bme18I GGWCC 1 cut(s) 188
BmgT120I GGNCC 1 cut(s) 188
BmiI GGNNCC 2 cut(s) 113, 190
BmtI GCTAGC 1 cut(s) 182
Bpu1102I GCTNAGC 1 cut(s) 252
Bsc4I CCNNNNNNNGG 2 cut(s) 68, 239
BseGI GGATG 2 cut(s) 58, 248
BseLI CCNNNNNNNGG 2 cut(s) 68, 239
BseMII CTCAG 1 cut(s) 266
BseXI GCAGC 1 cut(s) 209
BsgI GTGCAG 1 cut(s) 48
BshFI GGCC 1 cut(s) 78
BslFI GGGAC 2 cut(s) 174, 229
BslI CCNNNNNNNGG 2 cut(s) 68, 239
BsmFI GGGAC 2 cut(s) 174, 229
BsmI GAATGC 1 cut(s) 213
BsnI GGCC 1 cut(s) 78
Bsp143I GATC 1 cut(s) 111
Bsp1720I GCTNAGC 1 cut(s) 252
BspACI CCGC 1 cut(s) 249
BspANI GGCC 1 cut(s) 78
BspCNI CTCAG 1 cut(s) 265
BspLI GGNNCC 2 cut(s) 113, 190
BspOI GCTAGC 1 cut(s) 182
BspPI GGATC 2 cut(s) 106, 119
BsrBI CCGCTC 1 cut(s) 251
BssMI GATC 1 cut(s) 111
Bst6I CTCTTC 1 cut(s) 279
BstC8I GCNNGC 1 cut(s) 180
BstDEI CTNAG 3 cut(s) 93, 252, 257
BstF5I GGATG 2 cut(s) 58, 248
BstKTI GATC 1 cut(s) 114
BstMBI GATC 1 cut(s) 111
BstNSI RCATGY 1 cut(s) 178
BstSFI CTRYAG 1 cut(s) 66
BstV1I GCAGC 1 cut(s) 209
BstX2I RGATCY 1 cut(s) 111
BstYI RGATCY 1 cut(s) 111
BsuRI GGCC 1 cut(s) 78
BtsCI GGATG 2 cut(s) 58, 248
Cac8I GCNNGC 1 cut(s) 180
Cfr13I GGNCC 1 cut(s) 188
Csp6I GTAC 1 cut(s) 246
CviAII CATG 2 cut(s) 134, 175
CviJI RGCY 5 cut(s) 50, 78, 182, 222, 256
CviKI_1 RGCY 5 cut(s) 50, 78, 182, 222, 256
CviQI GTAC 1 cut(s) 246
DdeI CTNAG 3 cut(s) 93, 252, 257
DpnI GATC 1 cut(s) 113
DpnII GATC 1 cut(s) 111
Eam1104I CTCTTC 1 cut(s) 279
EarI CTCTTC 1 cut(s) 279
Eco47I GGWCC 1 cut(s) 188
EcoO109I RGGNCCY 1 cut(s) 188
EcoRI GAATTC 1 cut(s) 15
FaeI CATG 2 cut(s) 137, 178
FaiI YATR 6 cut(s) 87, 123, 135, 147, 176, 199
FaqI GGGAC 2 cut(s) 174, 229
FatI CATG 2 cut(s) 133, 174
Fnu4HI GCNGC 1 cut(s) 223
FokI GGATG 2 cut(s) 45, 255
Fsp4HI GCNGC 1 cut(s) 223
FspBI CTAG 5 cut(s) 24, 179, 183, 212, 219
GluI GCNGC 1 cut(s) 223
HaeIII GGCC 1 cut(s) 78
Hin1II CATG 2 cut(s) 137, 178
HincII GTYRAC 1 cut(s) 43
HindII GTYRAC 1 cut(s) 43
Hpy166II GTNNAC 1 cut(s) 43
Hpy8I GTNNAC 1 cut(s) 43
HpyAV CCTTC 1 cut(s) 92
HpyCH4IV ACGT 1 cut(s) 45
HpyCH4V TGCA 1 cut(s) 29
HpyF3I CTNAG 3 cut(s) 93, 252, 257
HpySE526I ACGT 1 cut(s) 45
Hsp92II CATG 2 cut(s) 137, 178
Kzo9I GATC 1 cut(s) 111
Lsp1109I GCAGC 1 cut(s) 209
MaeI CTAG 5 cut(s) 24, 179, 183, 212, 219
MaeII ACGT 1 cut(s) 45
MalI GATC 1 cut(s) 113
MbiI CCGCTC 1 cut(s) 251
MboI GATC 1 cut(s) 111
MboII GAAGA 2 cut(s) 44, 266
MflI RGATCY 1 cut(s) 111
MluCI AATT 2 cut(s) 15, 157
MnlI CCTC 5 cut(s) 31, 65, 73, 125, 179
MseI TTAA 3 cut(s) 107, 165, 279
Mva1269I GAATGC 1 cut(s) 213
NdeII GATC 1 cut(s) 111
NheI GCTAGC 1 cut(s) 178
NlaIII CATG 2 cut(s) 137, 178
NlaIV GGNNCC 2 cut(s) 113, 190
NspI RCATGY 1 cut(s) 178
PctI GAATGC 1 cut(s) 213
PkrI GCNGC 1 cut(s) 224
PpuMI RGGWCCY 1 cut(s) 188
Psp5II RGGWCCY 1 cut(s) 188
PspN4I GGNNCC 2 cut(s) 113, 190
PspPI GGNCC 1 cut(s) 188
PspPPI RGGWCCY 1 cut(s) 188
PsuI RGATCY 1 cut(s) 111
RsaI GTAC 1 cut(s) 247
RsaNI GTAC 1 cut(s) 246
SaqAI TTAA 3 cut(s) 107, 165, 279
SatI GCNGC 1 cut(s) 223
Sau3AI GATC 1 cut(s) 111
Sau96I GGNCC 1 cut(s) 188
SetI ASST 8 cut(s) 42, 48, 52, 76, 184, 190, 224, 258
SfcI CTRYAG 1 cut(s) 66
SinI GGWCC 1 cut(s) 188
Sse9I AATT 2 cut(s) 15, 157
SsiI CCGC 1 cut(s) 249
SspMI CTAG 5 cut(s) 24, 179, 183, 212, 219
TaiI ACGT 1 cut(s) 48
TasI AATT 2 cut(s) 15, 157
Tru1I TTAA 3 cut(s) 107, 165, 279
Tru9I TTAA 3 cut(s) 107, 165, 279
TseI GCWGC 1 cut(s) 222
TspDTI ATGAA 2 cut(s) 47, 183
VpaK11BI GGWCC 1 cut(s) 188
XapI RAATTY 1 cut(s) 15
XceI RCATGY 1 cut(s) 178
XspI CTAG 5 cut(s) 24, 179, 183, 212, 219
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.