Rh7DG205600

component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is involved in protein synthesis of a specialized repertoire of mRNAs and, together with other initiation factors, stimulates binding of mRNA and methionyl-tRNAi to the 40S ribosome. The eIF-3 complex specifically targets and initiates translation of a subset of mRNAs involved in cell proliferation

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
Physical Location & Seq
Forward (+)
19487162 .. 19500189
13028 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG205600.1

Sequence Viewer

Length: 222 bp
ATGCTAATGTACGTAGAAGTTCAAAAAAAGAATCAGGCTCGATCTCGAGTCCTTGAAGCATTAAATGCAAAGAGGGCACTGATGGCAATGCCTGCTCCTGATTTCAACCTTTGTCTCTTCCTAATTCCAGAAAGAGTGTGCCATGCTTGCTGGCCCAAAATGGGCACCCTTTACTTCTTGGCTCACTGGCTGGTAATTATATCTTTGCTTTGTCTCAACTAA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

73

Amino Acids

8.45

Weight (kDa)

9.13

Isoelectric Point (pI)

60.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 164
AfaI GTAC 1 cut(s) 11
AfiI CCNNNNNNNGG 1 cut(s) 161
AgsI TTSAA 3 cut(s) 23, 56, 106
Alw26I GTCTC 2 cut(s) 119, 218
Ama87I CYCGRG 1 cut(s) 45
AoxI GGCC 1 cut(s) 152
AspS9I GGNCC 1 cut(s) 153
AvaI CYCGRG 1 cut(s) 45
BaeGI GKGCMC 2 cut(s) 79, 167
BanI GGYRCC 1 cut(s) 164
BccI CCATC 1 cut(s) 76
BcoDI GTCTC 2 cut(s) 119, 218
BmeT110I CYCGRG 1 cut(s) 45
BmgT120I GGNCC 1 cut(s) 153
BmiI GGNNCC 1 cut(s) 166
BsaAI YACGTR 1 cut(s) 13
Bsc4I CCNNNNNNNGG 1 cut(s) 161
Bse1I ACTGG 1 cut(s) 191
Bse3DI GCAATG 1 cut(s) 93
BseLI CCNNNNNNNGG 1 cut(s) 161
BseMI GCAATG 1 cut(s) 93
BseNI ACTGG 1 cut(s) 191
BseSI GKGCMC 2 cut(s) 79, 167
BshFI GGCC 1 cut(s) 154
BshNI GGYRCC 1 cut(s) 164
BsiHKCI CYCGRG 1 cut(s) 45
BslI CCNNNNNNNGG 1 cut(s) 161
BsmAI GTCTC 2 cut(s) 119, 218
BsnI GGCC 1 cut(s) 154
BsoBI CYCGRG 1 cut(s) 45
Bsp1286I GDGCHC 2 cut(s) 79, 167
Bsp143I GATC 1 cut(s) 41
BspANI GGCC 1 cut(s) 154
BspLI GGNNCC 1 cut(s) 166
BspT107I GGYRCC 1 cut(s) 164
BsrDI GCAATG 1 cut(s) 93
BsrI ACTGG 1 cut(s) 191
BssMI GATC 1 cut(s) 41
Bst6I CTCTTC 1 cut(s) 122
BstAPI GCANNNNNTGC 2 cut(s) 65, 92
BstBAI YACGTR 1 cut(s) 13
BstC8I GCNNGC 3 cut(s) 93, 148, 152
BstKTI GATC 1 cut(s) 44
BstMAI GTCTC 2 cut(s) 119, 218
BstMBI GATC 1 cut(s) 41
BstMWI GCNNNNNNNGC 5 cut(s) 65, 74, 83, 92, 147
BstSLI GKGCMC 2 cut(s) 79, 167
BstSNI TACGTA 1 cut(s) 13
BsuRI GGCC 1 cut(s) 154
BtsIMutI CAGTG 2 cut(s) 77, 184
Cac8I GCNNGC 3 cut(s) 93, 148, 152
Cfr13I GGNCC 1 cut(s) 153
Csp6I GTAC 1 cut(s) 10
CviAII CATG 1 cut(s) 143
CviJI RGCY 4 cut(s) 38, 154, 182, 190
CviKI_1 RGCY 4 cut(s) 38, 154, 182, 190
CviQI GTAC 1 cut(s) 10
DpnI GATC 1 cut(s) 43
DpnII GATC 1 cut(s) 41
Eam1104I CTCTTC 1 cut(s) 122
EarI CTCTTC 1 cut(s) 122
Eco105I TACGTA 1 cut(s) 13
Eco88I CYCGRG 1 cut(s) 45
FaeI CATG 1 cut(s) 146
FaiI YATR 2 cut(s) 144, 200
FatI CATG 1 cut(s) 142
HaeIII GGCC 1 cut(s) 154
Hin1II CATG 1 cut(s) 146
HinfI GANTC 2 cut(s) 31, 48
Hpy188III TCNNGA 3 cut(s) 45, 98, 128
HpyCH4IV ACGT 1 cut(s) 12
HpyCH4V TGCA 1 cut(s) 68
HpyF10VI GCNNNNNNNGC 5 cut(s) 65, 74, 83, 92, 147
HpySE526I ACGT 1 cut(s) 12
Hsp92II CATG 1 cut(s) 146
Kzo9I GATC 1 cut(s) 41
LmnI GCTCC 1 cut(s) 100
LpnPI CCDG 7 cut(s) 20, 105, 111, 136, 141, 172, 176
MaeII ACGT 1 cut(s) 12
MalI GATC 1 cut(s) 43
MboI GATC 1 cut(s) 41
MboII GAAGA 1 cut(s) 109
MhlI GDGCHC 2 cut(s) 79, 167
MluCI AATT 2 cut(s) 123, 195
MlyI GAGTC 1 cut(s) 57
MnlI CCTC 1 cut(s) 66
MseI TTAA 1 cut(s) 62
MwoI GCNNNNNNNGC 5 cut(s) 65, 74, 83, 92, 147
NdeII GATC 1 cut(s) 41
NlaIII CATG 1 cut(s) 146
NlaIV GGNNCC 1 cut(s) 166
PaeR7I CTCGAG 1 cut(s) 45
PfeI GAWTC 1 cut(s) 31
PleI GAGTC 1 cut(s) 56
PpsI GAGTC 1 cut(s) 56
Ppu21I YACGTR 1 cut(s) 13
PspN4I GGNNCC 1 cut(s) 166
PspPI GGNCC 1 cut(s) 153
RsaI GTAC 1 cut(s) 11
RsaNI GTAC 1 cut(s) 10
SaqAI TTAA 1 cut(s) 62
Sau3AI GATC 1 cut(s) 41
Sau96I GGNCC 1 cut(s) 153
SchI GAGTC 1 cut(s) 57
SduI GDGCHC 2 cut(s) 79, 167
SetI ASST 2 cut(s) 15, 111
Sfr274I CTCGAG 1 cut(s) 45
SlaI CTCGAG 1 cut(s) 45
SmlI CTYRAG 1 cut(s) 45
SmoI CTYRAG 1 cut(s) 45
SnaBI TACGTA 1 cut(s) 13
Sse9I AATT 2 cut(s) 123, 195
TaiI ACGT 1 cut(s) 15
TaqI TCGA 2 cut(s) 40, 46
TasI AATT 2 cut(s) 123, 195
TfiI GAWTC 1 cut(s) 31
Tru1I TTAA 1 cut(s) 62
Tru9I TTAA 1 cut(s) 62
TscAI CASTG 2 cut(s) 84, 191
TspRI CASTG 2 cut(s) 84, 191
XhoI CTCGAG 1 cut(s) 45
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.