RchiOBHm_Chr6g0280791

WD40 repeats

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Forward (+)
44212443 .. 44216831
4389 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ25181

Sequence Viewer

Length: 237 bp
ATGAAACTTGTGAGAATTCTCTCTAGTGCAGAAGATGAGGTCAACGTAGCTTGTTTTCATCCTTCTGTCGGAGGTGGCATTGTTTATGGAACTAAGGAAGGAAAGTTAAGGATCCTCCAATATGATAGTTCTCATGCCGTGGGTCATACAACTTCTAATTTTCTTGATGAAAGCATGCTAGAGGCTTTGGATAAATCGAATAAGGAAGCACATTCTGAAGCTGGAACAGGACATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

78

Amino Acids

8.37

Weight (kDa)

5.62

Isoelectric Point (pI)

34.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 106, 119
AcsI RAATTY 1 cut(s) 15
AcuI CTGAAG 1 cut(s) 237
AfiI CCNNNNNNNGG 1 cut(s) 68
AluBI AGCT 2 cut(s) 50, 221
AluI AGCT 2 cut(s) 50, 221
AlwI GGATC 2 cut(s) 106, 119
ApoI RAATTY 1 cut(s) 15
BamHI GGATCC 1 cut(s) 111
BceAI ACGGC 1 cut(s) 122
BfaI CTAG 2 cut(s) 24, 179
BmiI GGNNCC 1 cut(s) 113
BsaJI CCNNGG 1 cut(s) 138
Bsc4I CCNNNNNNNGG 1 cut(s) 68
BseDI CCNNGG 1 cut(s) 138
BseGI GGATG 1 cut(s) 58
BseLI CCNNNNNNNGG 1 cut(s) 68
BsgI GTGCAG 1 cut(s) 48
BslI CCNNNNNNNGG 1 cut(s) 68
Bsp143I GATC 1 cut(s) 111
BspLI GGNNCC 1 cut(s) 113
BspPI GGATC 2 cut(s) 106, 119
BssECI CCNNGG 1 cut(s) 138
BssMI GATC 1 cut(s) 111
BstC8I GCNNGC 1 cut(s) 176
BstDEI CTNAG 1 cut(s) 93
BstDSI CCRYGG 1 cut(s) 138
BstF5I GGATG 1 cut(s) 58
BstKTI GATC 1 cut(s) 114
BstMBI GATC 1 cut(s) 111
BstNSI RCATGY 1 cut(s) 178
BstX2I RGATCY 1 cut(s) 111
BstYI RGATCY 1 cut(s) 111
BtgI CCRYGG 1 cut(s) 138
BtsCI GGATG 1 cut(s) 58
Cac8I GCNNGC 1 cut(s) 176
CviAII CATG 2 cut(s) 134, 175
CviJI RGCY 3 cut(s) 50, 185, 221
CviKI_1 RGCY 3 cut(s) 50, 185, 221
DdeI CTNAG 1 cut(s) 93
DpnI GATC 1 cut(s) 113
DpnII GATC 1 cut(s) 111
Eco57I CTGAAG 1 cut(s) 237
EcoRI GAATTC 1 cut(s) 15
FaeI CATG 2 cut(s) 137, 178
FaiI YATR 5 cut(s) 87, 123, 135, 147, 176
FatI CATG 2 cut(s) 133, 174
FokI GGATG 1 cut(s) 45
FspBI CTAG 2 cut(s) 24, 179
Hin1II CATG 2 cut(s) 137, 178
HincII GTYRAC 1 cut(s) 43
HindII GTYRAC 1 cut(s) 43
Hpy166II GTNNAC 1 cut(s) 43
Hpy188I TCNGA 2 cut(s) 71, 217
Hpy188III TCNNGA 1 cut(s) 164
Hpy8I GTNNAC 1 cut(s) 43
HpyAV CCTTC 2 cut(s) 72, 92
HpyCH4IV ACGT 1 cut(s) 45
HpyCH4V TGCA 1 cut(s) 29
HpyF3I CTNAG 1 cut(s) 93
HpySE526I ACGT 1 cut(s) 45
Hsp92II CATG 2 cut(s) 137, 178
Kzo9I GATC 1 cut(s) 111
LpnPI CCDG 2 cut(s) 207, 213
MaeI CTAG 2 cut(s) 24, 179
MaeII ACGT 1 cut(s) 45
MalI GATC 1 cut(s) 113
MboI GATC 1 cut(s) 111
MboII GAAGA 1 cut(s) 44
MflI RGATCY 1 cut(s) 111
MluCI AATT 2 cut(s) 15, 157
MmeI TCCRAC 1 cut(s) 49
MnlI CCTC 4 cut(s) 31, 65, 125, 175
MseI TTAA 1 cut(s) 107
NdeII GATC 1 cut(s) 111
NlaIII CATG 2 cut(s) 137, 178
NlaIV GGNNCC 1 cut(s) 113
NspI RCATGY 1 cut(s) 178
PaeI GCATGC 1 cut(s) 178
PspN4I GGNNCC 1 cut(s) 113
PsuI RGATCY 1 cut(s) 111
SaqAI TTAA 1 cut(s) 107
Sau3AI GATC 1 cut(s) 111
SetI ASST 5 cut(s) 42, 48, 52, 76, 223
SgeI CNNG 8 cut(s) 20, 36, 63, 146, 151, 176, 187, 191
SphI GCATGC 1 cut(s) 178
Sse9I AATT 2 cut(s) 15, 157
SspMI CTAG 2 cut(s) 24, 179
TaiI ACGT 1 cut(s) 48
TaqI TCGA 1 cut(s) 197
TasI AATT 2 cut(s) 15, 157
Tru1I TTAA 1 cut(s) 107
Tru9I TTAA 1 cut(s) 107
TspDTI ATGAA 3 cut(s) 17, 47, 183
XapI RAATTY 1 cut(s) 15
XceI RCATGY 1 cut(s) 178
XspI CTAG 2 cut(s) 24, 179
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.