Rh7DG205700

WD40 repeats

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
Physical Location & Seq
Forward (+)
19513452 .. 19513768
317 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG205700.1

Sequence Viewer

Length: 225 bp
ATGAAACTTGTGAGAATTCTCCCTAGTGCAGAAGATGAGGTCAACATAGCTTGTTTTCATCATTCTGTTGGAGGTGGCGTTGTTTATGGAACTAAGGAAGGGAAGTTAAGGATCCTCCAATATGATAGTTCTCATGCCGTGGGTCATACAACTTCCAATTTTCTTGAAGAAAACATGCTAGAGGTACAACAAGGCCCCAGTAGTTCATTTGTTTGTTTCTGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

74

Amino Acids

8.1

Weight (kDa)

5.68

Isoelectric Point (pI)

55.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 106, 119
AcsI RAATTY 1 cut(s) 15
AfaI GTAC 1 cut(s) 186
AgsI TTSAA 1 cut(s) 167
AluBI AGCT 1 cut(s) 50
AluI AGCT 1 cut(s) 50
AlwI GGATC 2 cut(s) 106, 119
AoxI GGCC 1 cut(s) 193
ApoI RAATTY 1 cut(s) 15
AspS9I GGNCC 1 cut(s) 194
BamHI GGATCC 1 cut(s) 111
BceAI ACGGC 1 cut(s) 122
BfaI CTAG 2 cut(s) 24, 179
BmgT120I GGNCC 1 cut(s) 194
BmiI GGNNCC 2 cut(s) 113, 196
BmrI ACTGGG 1 cut(s) 192
BmuI ACTGGG 1 cut(s) 192
BsaJI CCNNGG 1 cut(s) 138
BsaXI ACNNNNNCTCC 2 cut(s) 63, 93
Bse1I ACTGG 1 cut(s) 198
BseDI CCNNGG 1 cut(s) 138
BseNI ACTGG 1 cut(s) 198
BsgI GTGCAG 1 cut(s) 48
BshFI GGCC 1 cut(s) 195
BsnI GGCC 1 cut(s) 195
Bsp143I GATC 1 cut(s) 111
BspANI GGCC 1 cut(s) 195
BspLI GGNNCC 2 cut(s) 113, 196
BspPI GGATC 2 cut(s) 106, 119
BsrI ACTGG 1 cut(s) 198
BssECI CCNNGG 1 cut(s) 138
BssMI GATC 1 cut(s) 111
BstDEI CTNAG 1 cut(s) 93
BstDSI CCRYGG 1 cut(s) 138
BstKTI GATC 1 cut(s) 114
BstMBI GATC 1 cut(s) 111
BstNSI RCATGY 1 cut(s) 178
BstX2I RGATCY 1 cut(s) 111
BstYI RGATCY 1 cut(s) 111
BsuRI GGCC 1 cut(s) 195
BtgI CCRYGG 1 cut(s) 138
Cfr13I GGNCC 1 cut(s) 194
Csp6I GTAC 1 cut(s) 185
CviAII CATG 2 cut(s) 134, 175
CviJI RGCY 2 cut(s) 50, 195
CviKI_1 RGCY 2 cut(s) 50, 195
CviQI GTAC 1 cut(s) 185
DdeI CTNAG 1 cut(s) 93
DpnI GATC 1 cut(s) 113
DpnII GATC 1 cut(s) 111
EcoO109I RGGNCCY 1 cut(s) 194
EcoRI GAATTC 1 cut(s) 15
FaeI CATG 2 cut(s) 137, 178
FaiI YATR 6 cut(s) 47, 87, 123, 135, 147, 176
FatI CATG 2 cut(s) 133, 174
FspBI CTAG 2 cut(s) 24, 179
HaeIII GGCC 1 cut(s) 195
Hin1II CATG 2 cut(s) 137, 178
HincII GTYRAC 1 cut(s) 43
HindII GTYRAC 1 cut(s) 43
Hpy166II GTNNAC 1 cut(s) 43
Hpy188III TCNNGA 1 cut(s) 164
Hpy8I GTNNAC 1 cut(s) 43
HpyAV CCTTC 1 cut(s) 92
HpyCH4V TGCA 1 cut(s) 29
HpyF3I CTNAG 1 cut(s) 93
Hsp92II CATG 2 cut(s) 137, 178
Kzo9I GATC 1 cut(s) 111
LpnPI CCDG 1 cut(s) 211
MaeI CTAG 2 cut(s) 24, 179
MalI GATC 1 cut(s) 113
MboI GATC 1 cut(s) 111
MboII GAAGA 2 cut(s) 44, 179
MflI RGATCY 1 cut(s) 111
MluCI AATT 2 cut(s) 15, 157
MmeI TCCRAC 1 cut(s) 49
MnlI CCTC 4 cut(s) 31, 65, 125, 175
MseI TTAA 2 cut(s) 107, 223
NdeII GATC 1 cut(s) 111
NlaIII CATG 2 cut(s) 137, 178
NlaIV GGNNCC 2 cut(s) 113, 196
NspI RCATGY 1 cut(s) 178
PspN4I GGNNCC 2 cut(s) 113, 196
PspPI GGNCC 1 cut(s) 194
PsuI RGATCY 1 cut(s) 111
RsaI GTAC 1 cut(s) 186
RsaNI GTAC 1 cut(s) 185
SaqAI TTAA 2 cut(s) 107, 223
Sau3AI GATC 1 cut(s) 111
Sau96I GGNCC 1 cut(s) 194
SetI ASST 4 cut(s) 42, 52, 76, 186
Sse9I AATT 2 cut(s) 15, 157
SspMI CTAG 2 cut(s) 24, 179
TasI AATT 2 cut(s) 15, 157
Tru1I TTAA 2 cut(s) 107, 223
Tru9I TTAA 2 cut(s) 107, 223
TspDTI ATGAA 3 cut(s) 17, 47, 195
XapI RAATTY 1 cut(s) 15
XceI RCATGY 1 cut(s) 178
XspI CTAG 2 cut(s) 24, 179
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.