Rh2AG415200

WD40 repeats

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
Physical Location & Seq
Reverse (-)
61593192 .. 61593489
298 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG415200.1

Sequence Viewer

Length: 207 bp
ATGGAACTTGTGAGAATTCTCACTAGTGCAGAAGATGAGGTCAACGTAGCTTGTTTTCATCCCTCTGTAGGAGGTGGCCTTGTTTATGGAACTAAGGAAGGGAAGTTAAGGATCCTCCAATATGATAGTTCTCATGCCGTGGGTCATACAACTTCCAATTTTCTTAATGAAAACATGCTAGCTAGAGGTACAACAAGGCCCCAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

68

Amino Acids

7.42

Weight (kDa)

6.24

Isoelectric Point (pI)

37.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 106, 119
AcsI RAATTY 1 cut(s) 15
AfaI GTAC 1 cut(s) 190
AfiI CCNNNNNNNGG 1 cut(s) 68
AhlI ACTAGT 1 cut(s) 23
AluBI AGCT 2 cut(s) 50, 182
AluI AGCT 2 cut(s) 50, 182
AlwI GGATC 2 cut(s) 106, 119
AoxI GGCC 2 cut(s) 76, 197
ApoI RAATTY 1 cut(s) 15
AspS9I GGNCC 1 cut(s) 198
AsuNHI GCTAGC 1 cut(s) 178
BamHI GGATCC 1 cut(s) 111
BceAI ACGGC 1 cut(s) 122
BcuI ACTAGT 1 cut(s) 23
BfaI CTAG 3 cut(s) 24, 179, 183
BfmI CTRYAG 1 cut(s) 66
BmgT120I GGNCC 1 cut(s) 198
BmiI GGNNCC 2 cut(s) 113, 200
BmrI ACTGGG 1 cut(s) 196
BmtI GCTAGC 1 cut(s) 182
BmuI ACTGGG 1 cut(s) 196
BsaJI CCNNGG 1 cut(s) 138
Bsc4I CCNNNNNNNGG 1 cut(s) 68
Bse1I ACTGG 1 cut(s) 202
BseDI CCNNGG 1 cut(s) 138
BseGI GGATG 1 cut(s) 58
BseLI CCNNNNNNNGG 1 cut(s) 68
BseNI ACTGG 1 cut(s) 202
BsgI GTGCAG 1 cut(s) 48
BshFI GGCC 2 cut(s) 78, 199
BslI CCNNNNNNNGG 1 cut(s) 68
BsnI GGCC 2 cut(s) 78, 199
Bsp143I GATC 1 cut(s) 111
BspANI GGCC 2 cut(s) 78, 199
BspLI GGNNCC 2 cut(s) 113, 200
BspOI GCTAGC 1 cut(s) 182
BspPI GGATC 2 cut(s) 106, 119
BsrI ACTGG 1 cut(s) 202
BssECI CCNNGG 1 cut(s) 138
BssMI GATC 1 cut(s) 111
BstC8I GCNNGC 1 cut(s) 180
BstDEI CTNAG 1 cut(s) 93
BstDSI CCRYGG 1 cut(s) 138
BstF5I GGATG 1 cut(s) 58
BstKTI GATC 1 cut(s) 114
BstMBI GATC 1 cut(s) 111
BstNSI RCATGY 1 cut(s) 178
BstSFI CTRYAG 1 cut(s) 66
BstX2I RGATCY 1 cut(s) 111
BstYI RGATCY 1 cut(s) 111
BsuRI GGCC 2 cut(s) 78, 199
BtgI CCRYGG 1 cut(s) 138
BtsCI GGATG 1 cut(s) 58
Cac8I GCNNGC 1 cut(s) 180
Cfr13I GGNCC 1 cut(s) 198
Csp6I GTAC 1 cut(s) 189
CviAII CATG 2 cut(s) 134, 175
CviJI RGCY 4 cut(s) 50, 78, 182, 199
CviKI_1 RGCY 4 cut(s) 50, 78, 182, 199
CviQI GTAC 1 cut(s) 189
DdeI CTNAG 1 cut(s) 93
DpnI GATC 1 cut(s) 113
DpnII GATC 1 cut(s) 111
EcoO109I RGGNCCY 1 cut(s) 198
EcoRI GAATTC 1 cut(s) 15
FaeI CATG 2 cut(s) 137, 178
FaiI YATR 5 cut(s) 87, 123, 135, 147, 176
FatI CATG 2 cut(s) 133, 174
FokI GGATG 1 cut(s) 45
FspBI CTAG 3 cut(s) 24, 179, 183
HaeIII GGCC 2 cut(s) 78, 199
Hin1II CATG 2 cut(s) 137, 178
HincII GTYRAC 1 cut(s) 43
HindII GTYRAC 1 cut(s) 43
Hpy166II GTNNAC 1 cut(s) 43
Hpy8I GTNNAC 1 cut(s) 43
HpyAV CCTTC 1 cut(s) 92
HpyCH4IV ACGT 1 cut(s) 45
HpyCH4V TGCA 1 cut(s) 29
HpyF3I CTNAG 1 cut(s) 93
HpySE526I ACGT 1 cut(s) 45
Hsp92II CATG 2 cut(s) 137, 178
Kzo9I GATC 1 cut(s) 111
MaeI CTAG 3 cut(s) 24, 179, 183
MaeII ACGT 1 cut(s) 45
MalI GATC 1 cut(s) 113
MboI GATC 1 cut(s) 111
MboII GAAGA 1 cut(s) 44
MflI RGATCY 1 cut(s) 111
MluCI AATT 2 cut(s) 15, 157
MnlI CCTC 5 cut(s) 31, 65, 73, 125, 179
MseI TTAA 2 cut(s) 107, 165
NdeII GATC 1 cut(s) 111
NheI GCTAGC 1 cut(s) 178
NlaIII CATG 2 cut(s) 137, 178
NlaIV GGNNCC 2 cut(s) 113, 200
NspI RCATGY 1 cut(s) 178
PspN4I GGNNCC 2 cut(s) 113, 200
PspPI GGNCC 1 cut(s) 198
PsuI RGATCY 1 cut(s) 111
RsaI GTAC 1 cut(s) 190
RsaNI GTAC 1 cut(s) 189
SaqAI TTAA 2 cut(s) 107, 165
Sau3AI GATC 1 cut(s) 111
Sau96I GGNCC 1 cut(s) 198
SetI ASST 6 cut(s) 42, 48, 52, 76, 184, 190
SfcI CTRYAG 1 cut(s) 66
SgeI CNNG 9 cut(s) 20, 36, 63, 92, 146, 151, 187, 191, 195
SpeI ACTAGT 1 cut(s) 23
Sse9I AATT 2 cut(s) 15, 157
SspMI CTAG 3 cut(s) 24, 179, 183
TaiI ACGT 1 cut(s) 48
TasI AATT 2 cut(s) 15, 157
Tru1I TTAA 2 cut(s) 107, 165
Tru9I TTAA 2 cut(s) 107, 165
TspDTI ATGAA 2 cut(s) 47, 183
XapI RAATTY 1 cut(s) 15
XceI RCATGY 1 cut(s) 178
XspI CTAG 3 cut(s) 24, 179, 183
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.