Rh3CG096600

WD40 repeats

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3C
Physical Location & Seq
Forward (+)
7578832 .. 7581835
3004 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3CG096600.1

Sequence Viewer

Length: 237 bp
ATGGGGTCAACGGCGATGGAACTTGTGAGAATTCTCCCTAGTGCAGAAGATGAGGTCAACGTAGCTTGTTTTCATCCTTCTGTCGGAGGTGGCCTTGTTTATGGAACTAAGGCACTGATGGCAATGCCTGCTCCCGATTTCAACCTTTGTCTCTTCCTAATTCCAGAAAGAGTGTGCCATGCTTGCTGGCCCAAAATGGGCACCATTTGCTTCTTGGCTCACTGGCTGTTCCTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

78

Amino Acids

8.54

Weight (kDa)

5.78

Isoelectric Point (pI)

57.03

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 200
AcsI RAATTY 1 cut(s) 30
AfiI CCNNNNNNNGG 2 cut(s) 83, 197
AgsI TTSAA 1 cut(s) 142
AluBI AGCT 1 cut(s) 65
AluI AGCT 1 cut(s) 65
Alw26I GTCTC 1 cut(s) 155
AoxI GGCC 2 cut(s) 91, 188
ApoI RAATTY 1 cut(s) 30
AspS9I GGNCC 1 cut(s) 189
BaeGI GKGCMC 1 cut(s) 203
BanI GGYRCC 1 cut(s) 200
BccI CCATC 2 cut(s) 10, 112
BceAI ACGGC 1 cut(s) 27
BcoDI GTCTC 1 cut(s) 155
BfaI CTAG 1 cut(s) 39
BmgT120I GGNCC 1 cut(s) 189
BmiI GGNNCC 1 cut(s) 202
Bsc4I CCNNNNNNNGG 2 cut(s) 83, 197
Bse1I ACTGG 1 cut(s) 227
Bse3DI GCAATG 1 cut(s) 129
BseGI GGATG 1 cut(s) 73
BseLI CCNNNNNNNGG 2 cut(s) 83, 197
BseMI GCAATG 1 cut(s) 129
BseNI ACTGG 1 cut(s) 227
BseSI GKGCMC 1 cut(s) 203
BsgI GTGCAG 1 cut(s) 63
BshFI GGCC 2 cut(s) 93, 190
BshNI GGYRCC 1 cut(s) 200
BslI CCNNNNNNNGG 2 cut(s) 83, 197
BsmAI GTCTC 1 cut(s) 155
BsnI GGCC 2 cut(s) 93, 190
Bsp1286I GDGCHC 1 cut(s) 203
BspANI GGCC 2 cut(s) 93, 190
BspLI GGNNCC 1 cut(s) 202
BspT107I GGYRCC 1 cut(s) 200
BsrDI GCAATG 1 cut(s) 129
BsrI ACTGG 1 cut(s) 227
Bst6I CTCTTC 1 cut(s) 158
BstAPI GCANNNNNTGC 2 cut(s) 128, 207
BstC8I GCNNGC 3 cut(s) 129, 184, 188
BstDEI CTNAG 1 cut(s) 108
BstF5I GGATG 1 cut(s) 73
BstMAI GTCTC 1 cut(s) 155
BstMWI GCNNNNNNNGC 4 cut(s) 119, 128, 183, 207
BstSLI GKGCMC 1 cut(s) 203
BsuRI GGCC 2 cut(s) 93, 190
BtgZI GCGATG 1 cut(s) 29
BtsCI GGATG 1 cut(s) 73
BtsIMutI CAGTG 2 cut(s) 113, 220
Cac8I GCNNGC 3 cut(s) 129, 184, 188
Cfr13I GGNCC 1 cut(s) 189
CviAII CATG 1 cut(s) 179
CviJI RGCY 5 cut(s) 65, 93, 190, 218, 226
CviKI_1 RGCY 5 cut(s) 65, 93, 190, 218, 226
DdeI CTNAG 1 cut(s) 108
Eam1104I CTCTTC 1 cut(s) 158
EarI CTCTTC 1 cut(s) 158
EcoRI GAATTC 1 cut(s) 30
FaeI CATG 1 cut(s) 182
FaiI YATR 3 cut(s) 102, 180, 235
FatI CATG 1 cut(s) 178
FokI GGATG 1 cut(s) 60
FspBI CTAG 1 cut(s) 39
HaeIII GGCC 2 cut(s) 93, 190
Hin1II CATG 1 cut(s) 182
HincII GTYRAC 2 cut(s) 9, 58
HindII GTYRAC 2 cut(s) 9, 58
Hpy166II GTNNAC 2 cut(s) 9, 58
Hpy188I TCNGA 1 cut(s) 86
Hpy188III TCNNGA 2 cut(s) 134, 164
Hpy8I GTNNAC 2 cut(s) 9, 58
HpyAV CCTTC 1 cut(s) 87
HpyCH4IV ACGT 1 cut(s) 60
HpyCH4V TGCA 1 cut(s) 44
HpyF10VI GCNNNNNNNGC 4 cut(s) 119, 128, 183, 207
HpyF3I CTNAG 1 cut(s) 108
HpySE526I ACGT 1 cut(s) 60
Hsp92II CATG 1 cut(s) 182
LmnI GCTCC 1 cut(s) 136
LpnPI CCDG 4 cut(s) 141, 172, 177, 208
MaeI CTAG 1 cut(s) 39
MaeII ACGT 1 cut(s) 60
MboII GAAGA 2 cut(s) 59, 145
MhlI GDGCHC 1 cut(s) 203
MluCI AATT 2 cut(s) 30, 159
MmeI TCCRAC 1 cut(s) 64
MnlI CCTC 2 cut(s) 46, 80
MwoI GCNNNNNNNGC 4 cut(s) 119, 128, 183, 207
NlaIII CATG 1 cut(s) 182
NlaIV GGNNCC 1 cut(s) 202
PspN4I GGNNCC 1 cut(s) 202
PspPI GGNCC 1 cut(s) 189
Sau96I GGNCC 1 cut(s) 189
SduI GDGCHC 1 cut(s) 203
SetI ASST 5 cut(s) 57, 63, 67, 91, 147
Sse9I AATT 2 cut(s) 30, 159
SspMI CTAG 1 cut(s) 39
TaiI ACGT 1 cut(s) 63
TasI AATT 2 cut(s) 30, 159
TscAI CASTG 2 cut(s) 120, 227
TspDTI ATGAA 1 cut(s) 62
TspRI CASTG 2 cut(s) 120, 227
XapI RAATTY 1 cut(s) 30
XcmI CCANNNNNNNNNTGG 1 cut(s) 211
XspI CTAG 1 cut(s) 39
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.