RchiOBHm_Chr4g0427221

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
OG0000440
Physical Location & Seq
Forward (+)
52497154 .. 52500210
3057 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ39616

Sequence Viewer

Length: 186 bp
ATGACAGCACCAGACAAGATAAGAGAGGAATTAATAGAAGAGCATGACAAGGTGTTGGCTTATTTATCAAATGATGTAGAACAAATGGCAGTCCGAATTGAAGAACAACTTGATCGTGCAAAAGGAGGAAAACCCAAGTTATTATTGCAACTTTGGCATTTGGTGTCCAATTCGCGATTGCTATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

61

Amino Acids

7.08

Weight (kDa)

5.58

Isoelectric Point (pI)

54.9

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000440)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g20313 FvH4_2g11420 FvH4_2g11420 FvH4_2g11420 FvH4_2g11420 FvH4_2g11420 FvH4_2g11420 FvH4_2g11420 FvH4_2g11450 FvH4_2g11450 FvH4_2g11450 FvH4_2g11450 FvH4_2g11450 FvH4_2g11450 FvH4_2g11450 FvH4_2g11450 FvH4_2g11450 FvH4_5g25851
prunus_persica Prupe.8G072900_v2.0.a1 Prupe.8G072900_v2.0.a1 Prupe.8G072900_v2.0.a1 Prupe.8G073000_v2.0.a1 Prupe.8G073000_v2.0.a1 Prupe.8G073000_v2.0.a1 Prupe.8G229300_v2.0.a1 Prupe.8G229300_v2.0.a1 Prupe.8G229300_v2.0.a1 Prupe.8G229300_v2.0.a1 Prupe.8G229300_v2.0.a1 Prupe.8G229300_v2.0.a1 Prupe.8G229300_v2.0.a1
pyrus_communis pycom01g01210 pycom02g12000 pycom10g21410 pycom11g11060 pycom13g24280
rosa_chinensis RchiOBHm_Chr3g0461871 RchiOBHm_Chr4g0427221 RchiOBHm_Chr4g0427231 RchiOBHm_Chr6g0270081 RchiOBHm_Chr6g0270121 RchiOBHm_Chr6g0270151 RchiOBHm_Chr6g0270161 RchiOBHm_Chr6g0270171 RchiOBHm_Chr6g0270181 RchiOBHm_Chr6g0270191 RchiOBHm_Chr7g0229301
rosa_laevigata RLG00000013809 RLG00000013810 RLG00000013812 RLG00000013814 RLG00000013817 RLG00000013818
rosa_multiflora Rmu_sc0000918.1_g000004 Rmu_sc0000918.1_g000019 Rmu_sc0000918.1_g000027 Rmu_sc0002817.1_g000013 Rmu_sc0004366.1_g000009 Rmu_sc0004376.1_g000011 Rmu_sc0004376.1_g000014 Rmu_sc0004376.1_g000021 Rmu_sc0006909.1_g000002 Rmu_sc0011356.1_g000003 Rmu_sc0011369.1_g000005 Rmu_sc0017552.1_g000001
rosa_roxburghii Rroxscaffold_5G00354200 Rroxscaffold_7G00198080 Rroxscaffold_7G00198090 Rroxscaffold_7G00198100 Rroxscaffold_7G00198130 Rroxscaffold_7G00198170
rosa_rugosa Rorug06G0052400 Rorug06G0052500 Rorug06G0053000
rosa_samantha Rh6AG171300 Rh6AG171400 Rh6AG171800 Rh6AG171900 Rh6AG172000 Rh6AG172100 Rh6AG369700 Rh6BG175800 Rh6BG175900 Rh6BG176200 Rh6BG176300 Rh6CG170900 Rh6CG171100 Rh6CG171400 Rh6CG171500 Rh6CG171700 Rh6CG171900 Rh6CG172000 Rh6CG172100
rosa_wichuraiana Rw6G014730

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 175
AgsI TTSAA 1 cut(s) 101
AseI ATTAAT 1 cut(s) 32
BfmI CTRYAG 1 cut(s) 182
Bsh1236I CGCG 1 cut(s) 175
Bsp143I GATC 1 cut(s) 112
Bsp68I TCGCGA 1 cut(s) 175
BspFNI CGCG 1 cut(s) 175
BspQI GCTCTTC 1 cut(s) 33
BssMI GATC 1 cut(s) 112
Bst6I CTCTTC 1 cut(s) 33
BstFNI CGCG 1 cut(s) 175
BstKTI GATC 1 cut(s) 115
BstMBI GATC 1 cut(s) 112
BstMWI GCNNNNNNNGC 1 cut(s) 154
BstSFI CTRYAG 1 cut(s) 182
BstUI CGCG 1 cut(s) 175
BtuMI TCGCGA 1 cut(s) 175
CviAII CATG 1 cut(s) 44
CviJI RGCY 1 cut(s) 59
CviKI_1 RGCY 1 cut(s) 59
DpnI GATC 1 cut(s) 114
DpnII GATC 1 cut(s) 112
Eam1104I CTCTTC 1 cut(s) 33
EarI CTCTTC 1 cut(s) 33
FaeI CATG 1 cut(s) 47
FaiI YATR 2 cut(s) 45, 184
FalI AAGNNNNNCTT 2 cut(s) 93, 125
FatI CATG 1 cut(s) 43
Hin1II CATG 1 cut(s) 47
Hpy188I TCNGA 1 cut(s) 95
Hpy188III TCNNGA 1 cut(s) 174
HpyCH4V TGCA 2 cut(s) 119, 148
HpyF10VI GCNNNNNNNGC 1 cut(s) 154
Hsp92II CATG 1 cut(s) 47
Kzo9I GATC 1 cut(s) 112
LguI GCTCTTC 1 cut(s) 33
LpnPI CCDG 1 cut(s) 24
MalI GATC 1 cut(s) 114
MboI GATC 1 cut(s) 112
MboII GAAGA 2 cut(s) 50, 113
MluCI AATT 3 cut(s) 29, 96, 169
MnlI CCTC 2 cut(s) 19, 119
MseI TTAA 1 cut(s) 32
MvnI CGCG 1 cut(s) 175
MwoI GCNNNNNNNGC 1 cut(s) 154
NdeII GATC 1 cut(s) 112
NlaIII CATG 1 cut(s) 47
NruI TCGCGA 1 cut(s) 175
PciSI GCTCTTC 1 cut(s) 33
PshBI ATTAAT 1 cut(s) 32
RruI TCGCGA 1 cut(s) 175
SapI GCTCTTC 1 cut(s) 33
SaqAI TTAA 1 cut(s) 32
Sau3AI GATC 1 cut(s) 112
SetI ASST 1 cut(s) 54
SfcI CTRYAG 1 cut(s) 182
SgeI CNNG 7 cut(s) 23, 28, 56, 61, 122, 128, 148
Sse9I AATT 3 cut(s) 29, 96, 169
TasI AATT 3 cut(s) 29, 96, 169
Tru1I TTAA 1 cut(s) 32
Tru9I TTAA 1 cut(s) 32
VspI ATTAAT 1 cut(s) 32
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.