RchiOBHm_Chr5g0073171

Belongs to the cytochrome P450 family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
OG0000704
Physical Location & Seq
Forward (+)
79254187 .. 79255072
886 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ34808

Sequence Viewer

Length: 309 bp
ATGGCAGGAGATACAAAGTTACAAACGATGAAATACACATGGAGAGTTGCACAAGAGTTGATGAGGATGATTCCTCCTGTGTTTGGAAGCTTTAGAAAAATACTCAAAGACACTCAATATGGTGGCTATGACATTCCCAAAGGATGGCAGTTTGCTAGAGTTGAAGTCCTCACAACCATCCACAATTTGGTGACAATGTTTGAGTGGTCACAGGTGTACCCTGAGGAAAAGATAACCCGTCAACCAATGCATTATCCATCCATGGGTCTCCCAATCAAGATCAAACCAAGAATTCCTAAATTTGTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
p450

Protein Analysis

102

Amino Acids

12.06

Weight (kDa)

9.87

Isoelectric Point (pI)

33.44

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
p450 PF00067 6 - 49 3.5e-07 Cytochrome P450
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 2 cut(s) 144, 187
AcsI RAATTY 2 cut(s) 291, 299
AfaI GTAC 1 cut(s) 218
AfiI CCNNNNNNNGG 4 cut(s) 83, 144, 187, 263
AgsI TTSAA 1 cut(s) 164
AluBI AGCT 1 cut(s) 90
AluI AGCT 1 cut(s) 90
Alw26I GTCTC 1 cut(s) 272
ApoI RAATTY 2 cut(s) 291, 299
AsuHPI GGTGA 1 cut(s) 202
AxyI CCTNAGG 1 cut(s) 222
BaeI ACNNNNGTAYC 2 cut(s) 200, 233
BccI CCATC 3 cut(s) 138, 185, 265
BcoDI GTCTC 1 cut(s) 272
BfaI CTAG 1 cut(s) 156
BsaI GGTCTC 1 cut(s) 272
BsaJI CCNNGG 1 cut(s) 261
Bsc4I CCNNNNNNNGG 4 cut(s) 83, 144, 187, 263
Bse21I CCTNAGG 1 cut(s) 222
BseDI CCNNGG 1 cut(s) 261
BseGI GGATG 4 cut(s) 72, 149, 177, 257
BseLI CCNNNNNNNGG 4 cut(s) 83, 144, 187, 263
BseMII CTCAG 1 cut(s) 213
BslI CCNNNNNNNGG 4 cut(s) 83, 144, 187, 263
BsmAI GTCTC 1 cut(s) 272
Bso31I GGTCTC 1 cut(s) 272
Bsp143I GATC 1 cut(s) 279
Bsp19I CCATGG 1 cut(s) 261
BspCNI CTCAG 1 cut(s) 214
BspTNI GGTCTC 1 cut(s) 272
BssECI CCNNGG 1 cut(s) 261
BssMI GATC 1 cut(s) 279
BssT1I CCWWGG 1 cut(s) 261
BstDEI CTNAG 1 cut(s) 222
BstDSI CCRYGG 1 cut(s) 261
BstF5I GGATG 4 cut(s) 72, 149, 177, 257
BstKTI GATC 1 cut(s) 282
BstMAI GTCTC 1 cut(s) 272
BstMBI GATC 1 cut(s) 279
Bsu36I CCTNAGG 1 cut(s) 222
BtgI CCRYGG 1 cut(s) 261
BtsCI GGATG 4 cut(s) 72, 149, 177, 257
Csp6I GTAC 1 cut(s) 217
CviAII CATG 2 cut(s) 39, 262
CviJI RGCY 2 cut(s) 90, 126
CviKI_1 RGCY 2 cut(s) 90, 126
CviQI GTAC 1 cut(s) 217
DdeI CTNAG 1 cut(s) 222
DpnI GATC 1 cut(s) 281
DpnII GATC 1 cut(s) 279
Eco130I CCWWGG 1 cut(s) 261
Eco31I GGTCTC 1 cut(s) 272
Eco81I CCTNAGG 1 cut(s) 222
EcoRI GAATTC 1 cut(s) 291
EcoT14I CCWWGG 1 cut(s) 261
EcoT22I ATGCAT 1 cut(s) 252
ErhI CCWWGG 1 cut(s) 261
FaeI CATG 2 cut(s) 42, 265
FaiI YATR 5 cut(s) 40, 120, 129, 263, 307
FatI CATG 2 cut(s) 38, 261
FokI GGATG 4 cut(s) 79, 156, 164, 244
FspBI CTAG 1 cut(s) 156
Hin1II CATG 2 cut(s) 42, 265
HincII GTYRAC 1 cut(s) 242
HindII GTYRAC 1 cut(s) 242
HindIII AAGCTT 1 cut(s) 88
HinfI GANTC 1 cut(s) 70
HphI GGTGA 1 cut(s) 202
Hpy166II GTNNAC 2 cut(s) 217, 242
Hpy188III TCNNGA 1 cut(s) 277
Hpy8I GTNNAC 2 cut(s) 217, 242
HpyCH4V TGCA 2 cut(s) 50, 250
HpyF3I CTNAG 1 cut(s) 222
Hsp92II CATG 2 cut(s) 42, 265
Kzo9I GATC 1 cut(s) 279
LpnPI CCDG 3 cut(s) 90, 197, 234
MaeI CTAG 1 cut(s) 156
MaeIII GTNAC 3 cut(s) 18, 190, 207
MalI GATC 1 cut(s) 281
MboI GATC 1 cut(s) 279
MluCI AATT 3 cut(s) 184, 291, 299
MnlI CCTC 4 cut(s) 57, 84, 179, 217
Mph1103I ATGCAT 1 cut(s) 252
NcoI CCATGG 1 cut(s) 261
NdeII GATC 1 cut(s) 279
NlaIII CATG 2 cut(s) 42, 265
NmuCI GTSAC 2 cut(s) 190, 207
NsiI ATGCAT 1 cut(s) 252
PfeI GAWTC 1 cut(s) 70
PflMI CCANNNNNTGG 2 cut(s) 144, 187
RsaI GTAC 1 cut(s) 218
RsaNI GTAC 1 cut(s) 217
Sau3AI GATC 1 cut(s) 279
SetI ASST 2 cut(s) 92, 216
Sse9I AATT 3 cut(s) 184, 291, 299
SspMI CTAG 1 cut(s) 156
StyI CCWWGG 1 cut(s) 261
TasI AATT 3 cut(s) 184, 291, 299
TfiI GAWTC 1 cut(s) 70
TseFI GTSAC 2 cut(s) 190, 207
Tsp45I GTSAC 2 cut(s) 190, 207
TspDTI ATGAA 1 cut(s) 44
Van91I CCANNNNNTGG 2 cut(s) 144, 187
XapI RAATTY 2 cut(s) 291, 299
XcmI CCANNNNNNNNNTGG 1 cut(s) 184
XspI CTAG 1 cut(s) 156
Zsp2I ATGCAT 1 cut(s) 252
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.