RchiOBHm_Chr7g0229911

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
OG0000615
Physical Location & Seq
Forward (+)
53395819 .. 53396369
551 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ20598

Sequence Viewer

Length: 216 bp
ATGGATTTTGGCCGAACCTCGTTAAAACTTGTTGTCTTCTTAGTTTGCTTATTTATTCTTTCCATCTCTACTAGTAGTACTTGCGTGACGGGGATTAATTTCCCAACACCTCCCTGTTCATTGCTTACATCAAATGTTAAATGTGTTACCACTTTACCAGAAATATTGTTGTCATTGTCATTTGTTGTTCCAAAAAATAAAATTGGTCTTTATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

71

Amino Acids

7.68

Weight (kDa)

8.86

Isoelectric Point (pI)

24.92

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000615)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G33970 AT1G33970 AT1G33970 AT1G33970 AT1G33970
fragaria_vesca FvH4_5g32530 FvH4_5g32530
malus_domestica MD15G1403700.v1.1
prunus_persica Prupe.1G549700_v2.0.a1 Prupe.1G549700_v2.0.a1
pyrus_communis pycom15g36100
rosa_chinensis RchiOBHm_Chr7g0226331 RchiOBHm_Chr7g0229101 RchiOBHm_Chr7g0229111 RchiOBHm_Chr7g0229141 RchiOBHm_Chr7g0229161 RchiOBHm_Chr7g0229171 RchiOBHm_Chr7g0229211 RchiOBHm_Chr7g0229241 RchiOBHm_Chr7g0229381 RchiOBHm_Chr7g0229761 RchiOBHm_Chr7g0229911
rosa_laevigata RLG00000000796 RLG00000001464 RLG00000001466 RLG00000001469 RLG00000001523 RLG00000001526 RLG00000001529 RLG00000001530 RLG00000001749 RLG00000001913 RLG00000002114 RLG00000002115 RLG00000023248 RLG00000023250
rosa_multiflora Rmu_co8281135.1_g000001 Rmu_sc0000271.1_g000002 Rmu_sc0000271.1_g000007 Rmu_sc0000271.1_g000014 Rmu_sc0000693.1_g000012 Rmu_sc0000693.1_g000015 Rmu_sc0000693.1_g000023 Rmu_sc0001044.1_g000005 Rmu_sc0006689.1_g000007 Rmu_sc0012733.1_g000005
rosa_roxburghii Rroxscaffold_3G00230540 Rroxscaffold_3G00230590 Rroxscaffold_3G00230600 Rroxscaffold_3G00230700 Rroxscaffold_3G00230710 Rroxscaffold_3G00232980 Rroxscaffold_3G00237610
rosa_rugosa Rorug07G0203800 Rorug07G0203900 Rorug07G0256100 Rorug07G0256400 Rorug07G0256400 Rorug07G0256400 Rorug07G0256500 Rorug07G0256600 Rorug07G0256600 Rorug07G0257100 Rorug07G0257200 Rorug07G0257300 Rorug07G0257400
rosa_samantha Rh7DG401100 Rh7DG401300 Rh7DG401900 Rh7DG402100 Rh7DG402300 Rh7DG402700
rosa_wichuraiana Rw0G001910 Rw0G001930 Rw0G001940 Rw7G033790 Rw7G033810 Rw7G033840 Rw7G033900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 10
AfaI GTAC 1 cut(s) 79
AhlI ACTAGT 1 cut(s) 71
AoxI GGCC 1 cut(s) 10
AseI ATTAAT 1 cut(s) 96
BbsI GAAGAC 1 cut(s) 28
BccI CCATC 1 cut(s) 71
BcuI ACTAGT 1 cut(s) 71
BfaI CTAG 1 cut(s) 72
BmcAI AGTACT 1 cut(s) 79
BpiI GAAGAC 1 cut(s) 28
Bse3DI GCAATG 1 cut(s) 119
BseMI GCAATG 1 cut(s) 119
BshFI GGCC 1 cut(s) 12
BsnI GGCC 1 cut(s) 12
BspANI GGCC 1 cut(s) 12
BsrDI GCAATG 1 cut(s) 119
BstDEI CTNAG 1 cut(s) 40
BstV2I GAAGAC 1 cut(s) 28
BsuRI GGCC 1 cut(s) 12
Csp6I GTAC 1 cut(s) 78
CviJI RGCY 1 cut(s) 12
CviKI_1 RGCY 1 cut(s) 12
CviQI GTAC 1 cut(s) 78
DdeI CTNAG 1 cut(s) 40
EaeI YGGCCR 1 cut(s) 10
FspBI CTAG 1 cut(s) 72
HaeIII GGCC 1 cut(s) 12
HpyF3I CTNAG 1 cut(s) 40
LpnPI CCDG 2 cut(s) 127, 171
MaeI CTAG 1 cut(s) 72
MaeIII GTNAC 2 cut(s) 85, 145
MboII GAAGA 1 cut(s) 28
MluCI AATT 2 cut(s) 97, 201
MnlI CCTC 2 cut(s) 28, 120
MseI TTAA 4 cut(s) 23, 96, 138, 214
NmuCI GTSAC 1 cut(s) 85
PshBI ATTAAT 1 cut(s) 96
RsaI GTAC 1 cut(s) 79
RsaNI GTAC 1 cut(s) 78
SaqAI TTAA 4 cut(s) 23, 96, 138, 214
ScaI AGTACT 1 cut(s) 79
SetI ASST 2 cut(s) 20, 112
SgeI CNNG 8 cut(s) 31, 41, 84, 93, 97, 102, 126, 170
SpeI ACTAGT 1 cut(s) 71
Sse9I AATT 2 cut(s) 97, 201
SspI AATATT 1 cut(s) 165
SspMI CTAG 1 cut(s) 72
TasI AATT 2 cut(s) 97, 201
TatI WGTACW 1 cut(s) 77
Tru1I TTAA 4 cut(s) 23, 96, 138, 214
Tru9I TTAA 4 cut(s) 23, 96, 138, 214
TseFI GTSAC 1 cut(s) 85
Tsp45I GTSAC 1 cut(s) 85
TspDTI ATGAA 1 cut(s) 108
VspI ATTAAT 1 cut(s) 96
XspI CTAG 1 cut(s) 72
ZrmI AGTACT 1 cut(s) 79
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.